Strain Name:
C57BL/6J-MtgxR8098Btlr/Mmmh
Stock Number:
067530-MU
Citation ID:
RRID:MMRRC_067530-MU
Other Names:
R8098 (G1)
Major Collection:

Strain Information

Gpd2
Name: glycerol phosphate dehydrogenase 2, mitochondrial
Synonyms: Gdm1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14571
HGNC: HGNC:4456
Homologene: 352
Hgf
Name: hepatocyte growth factor
Synonyms: NK2, SF/HGF, HGF/SF, C230052L06Rik, scatter factor, NK1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15234
HGNC: HGNC:4893
Homologene: 503
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Egf
Name: epidermal growth factor
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13645
HGNC: HGNC:3229
Homologene: 1483
Atp1a1
Name: ATPase, Na+/K+ transporting, alpha 1 polypeptide
Synonyms: Atpa-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11928
HGNC: HGNC:799
Homologene: 564
Tet1
Name: tet methylcytosine dioxygenase 1
Synonyms: Cxxc6, BB001228, 2510010B09Rik, D10Ertd17e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52463
Homologene: 12735
Ep400
Name: E1A binding protein p400
Synonyms: 1700020J09Rik, mDomino, p400
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Rnf10
Name: ring finger protein 10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50849
Homologene: 40990
Utp20
Name: UTP20 small subunit processome component
Synonyms: 3830408P06Rik, DRIM, mDRIM
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Ddx50
Name: DExD box helicase 50
Synonyms: GU2, 4933429B04Rik, 8430408E17Rik, RH-II/Gubeta, DEAD (Asp-Glu-Ala-Asp) box polypeptide 50
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 94213
VEGA: 10
Homologene: 56986
Snx5
Name: sorting nexin 5
Synonyms: 0910001N05Rik, D2Ertd52e, 1810032P22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69178
Homologene: 40944
Bms1
Name: BMS1, ribosome biogenesis factor
Synonyms: Bms1l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213895
Homologene: 7065
Myo18a
Name: myosin XVIIIA
Synonyms: MyoPDZ
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 360013
Homologene: 7977
Tango6
Name: transport and golgi organization 6
Synonyms: Tango6, Tmco7
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 272538
Homologene: 52121
Depdc1b
Name: DEP domain containing 1B
Synonyms: XTP1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218581
Homologene: 10157
Kctd17
Name: potassium channel tetramerisation domain containing 17
Synonyms: 2900008M13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72844
Homologene: 23468
Gins4
Name: GINS complex subunit 4
Synonyms: SLD5, 2810037C03Rik, 4933405K01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109145
Homologene: 5759
Zfp866
Name: zinc finger protein 866
Synonyms: D330038O06Rik, 9830167H18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330788
Adnp
Name: activity-dependent neuroprotective protein
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11538
Homologene: 7617
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: TR7, Death receptor 6, DR6
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 94185
VEGA: 17
Homologene: 8696
Tk2
Name: thymidine kinase 2, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 57813
Homologene: 3392
Soat1
Name: sterol O-acyltransferase 1
Synonyms: ACAT-1, Acact, hid, 8430426K15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20652
Homologene: 2333
Scube1
Name: signal peptide, CUB domain, EGF-like 1
Synonyms: A630023E24Rik, 7330410C13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64706
Homologene: 11224
Cpt1a
Name: carnitine palmitoyltransferase 1a, liver
Synonyms: L-CPT I, CPTI, Cpt1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12894
VEGA: 19
HGNC: HGNC:2328
Homologene: 1413
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: Crpd, CRP-[a], ebnerin, hensin, MUCLIN, gp300, vomeroglandin, CRP-[b]
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Btla
Name: B and T lymphocyte associated
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208154
Homologene: 52233
Slc22a3
Name: solute carrier family 22 (organic cation transporter), member 3
Synonyms: Orct3, Oct3, EMT
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20519
VEGA: 17
Homologene: 22630
Atp13a3
Name: ATPase type 13A3
Synonyms: LOC385637, LOC224088, LOC224087
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224088
Homologene: 23455
Igfbp3
Name: insulin-like growth factor binding protein 3
Synonyms: IGFBP-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16009
HGNC: HGNC:5472
Homologene: 500
Sidt2
Name: SID1 transmembrane family, member 2
Synonyms: CGI-40
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214597
Homologene: 22943
Calcoco1
Name: calcium binding and coiled coil domain 1
Synonyms: 1810009B06Rik, CoCoA, Gcap11
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67488
Homologene: 10845
Ms4a14
Name: membrane-spanning 4-domains, subfamily A, member 14
Synonyms: LOC383435
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 383435
Homologene: 138453
Kif13a
Name: kinesin family member 13A
Synonyms: N-3 kinesin, 4930505I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16553
VEGA: 13
Homologene: 22589
Hnrnpdl
Name: heterogeneous nuclear ribonucleoprotein D-like
Synonyms: D5Ertd650e, JKTBP, D5Wsu145e, hnRNP-DL, Hnrpdl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 50926
HGNC: HGNC:5037
Homologene: 75314
Snx11
Name: sorting nexin 11
Synonyms: A930041K09Rik, 4933439F10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74479
Homologene: 12568
Nipal3
Name: NIPA-like domain containing 3
Synonyms: 9130020G22Rik, Npal3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74552
Homologene: 10722
Akap11
Name: A kinase anchor protein 11
Synonyms: 6330501D17Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219181
HGNC: HGNC:369
Homologene: 8279
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Sucnr1
Name: succinate receptor 1
Synonyms: Gpr91
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 84112
HGNC: HGNC:4542
Homologene: 41865
Ell3
Name: elongation factor RNA polymerase II-like 3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269344
Homologene: 11859
Il16
Name: interleukin 16
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16170
HGNC: HGNC:5980
Homologene: 18157
Zkscan17
Name: zinc finger with KRAB and SCAN domains 17
Synonyms: Nizp1, Zfp496
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268417
Homologene: 13108
Tek
Name: TEK receptor tyrosine kinase
Synonyms: tie-2, Hyk, Cd202b, Tie2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 21687
Homologene: 397
Adam15
Name: ADAM metallopeptidase domain 15
Synonyms: metargidin, MDC15
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11490
HGNC: HGNC:193
Homologene: 2829
Ckap4
Name: cytoskeleton-associated protein 4
Synonyms: P63, 5630400A09Rik, CLIMP-63
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216197
VEGA: 10
Homologene: 4970
Lrp1
Name: low density lipoprotein receptor-related protein 1
Synonyms: CD91, b2b1554Clo, A2mr
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16971
HGNC: HGNC:6692
Homologene: 1744
Snx7
Name: sorting nexin 7
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76561
Homologene: 22941
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Dnah17
Name: dynein, axonemal, heavy chain 17
Synonyms: LOC382552, 2810003K23Rik, Dnahcl1, Dnahc17
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69926
HGNC: HGNC:2946
Homologene: 72102
Col7a1
Name: collagen, type VII, alpha 1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12836
HGNC: HGNC:2214
Homologene: 73
Kcnn4
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Synonyms: IK1, mIKCa1, SK4, IKCa1, KCa3.1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16534
HGNC: HGNC:6293
Homologene: 1696
Col6a3
Name: collagen, type VI, alpha 3
Synonyms: Col6a-3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12835
HGNC: HGNC:2213
Homologene: 37917
Zfp282
Name: zinc finger protein 282
Synonyms: HUB1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101095
Homologene: 2647
Prph2
Name: peripherin 2
Synonyms: Nmf193, rds, Rd2, Tspan22
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19133
HGNC: HGNC:9942
Homologene: 273
Abca15
Name: ATP-binding cassette, sub-family A member 15
Synonyms: 4930500I12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320631
Homologene: 87255
Slc20a1
Name: solute carrier family 20, member 1
Synonyms: Glvr1, PiT-1, Glvr-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20515
Homologene: 38049
Exoc3
Name: exocyst complex component 3
Synonyms: E430013E20Rik, Sec6l1, 2810050O03Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 211446
VEGA: 13
Homologene: 38296
Fbxl13
Name: F-box and leucine-rich repeat protein 13
Synonyms: 4921539K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320118
Homologene: 27057
Abcc6
Name: ATP-binding cassette, sub-family C member 6
Synonyms: Mrp6, DCC, Dyscalc1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 27421
HGNC: HGNC:57
Homologene: 55559
Btn2a2
Name: butyrophilin, subfamily 2, member A2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238555
Homologene: 56012
Pxdn
Name: peroxidasin
Synonyms: 2310075M15Rik, VPO1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 69675
Homologene: 33907
Wdr91
Name: WD repeat domain 91
Synonyms: 9530020G05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101240
Homologene: 8562
Supv3l1
Name: suppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms: 6330443E10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 338359
Homologene: 2386
Pcnx2
Name: pecanex homolog 2
Synonyms: Pcnxl2, E330039K12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270109
HGNC: HGNC:8736
Homologene: 8987
Samd9l
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209086
HGNC: HGNC:1349
Homologene: 7707
Ccdc192
Name: coiled-coil domain containing 192
Synonyms: 1700011I03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75444
Homologene: 133296
Tmcc3
Name: transmembrane and coiled coil domains 3
Synonyms: LOC380656, C630016B22Rik, A230066D03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 319880
Homologene: 10792
Tm6sf2
Name: transmembrane 6 superfamily member 2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 107770
Homologene: 77694
Ttc7
Name: tetratricopeptide repeat domain 7
Synonyms: 1700007L07Rik, fsn, hea, 1110035E02Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225049
Homologene: 12515
Dgkq
Name: diacylglycerol kinase, theta
Synonyms: Dgk theta, 110kDa, Dagk4, DAGK7, Dgkd
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 110524
HGNC: HGNC:2856
Homologene: 20352
B3glct
Name: beta-3-glucosyltransferase
Synonyms: B3galtl, LOC381694
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381694
Homologene: 14978
Cyp2c23
Name: cytochrome P450, family 2, subfamily c, polypeptide 23
Synonyms: Cyp2c44
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226143
Homologene: 115563
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Nek4
Name: NIMA (never in mitosis gene a)-related expressed kinase 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 23955
VEGA: 14
Homologene: 2376
Tgm1
Name: transglutaminase 1, K polypeptide
Synonyms: TG K, protein-glutamine-gamma-glutamyltransferase, K polypeptide, TGase1, 2310004J08Rik, TGase 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21816
VEGA: 14
Homologene: 306
C1ra
Name: complement component 1, r subcomponent A
Synonyms: mC1rA
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 50909
HGNC: HGNC:1246
Homologene: 1313
Ugt2b36
Name: UDP glucuronosyltransferase 2 family, polypeptide B36
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231396
Homologene: 128251
Or4c122
Name: olfactory receptor family 4 subfamily C member 122
Synonyms: Olfr1228, GA_x6K02T2Q125-50696209-50695274, MOR233-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258973
Homologene: 74217
Thrb
Name: thyroid hormone receptor beta
Synonyms: Nr1a2, c-erbAbeta, T3Rbeta, T3R[b], Thrb1, TR beta, Thrb2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21834
Homologene: 36025
Fem1al
Name: fem-1 homolog A like
Synonyms: 4931440F15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216622
Map3k9
Name: mitogen-activated protein kinase kinase kinase 9
Synonyms: Mlk1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 338372
VEGA: 12
HGNC: HGNC:6861
Homologene: 76377
Zfp764l1
Name: zinc finger protein 764 like 1
Synonyms: E430018J23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101604
Homologene: 138471
Nlrp6
Name: NLR family, pyrin domain containing 6
Synonyms: Nalp6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101613
Homologene: 15881
Or13p4
Name: olfactory receptor family 13 subfamily P member 4
Synonyms: Olfr1342, GA_x6K02T2QD9B-18856980-18857927, MOR258-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258708
Homologene: 17357
Mkx
Name: mohawk homeobox
Synonyms: Irxl1, 9430023B20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 210719
Homologene: 72239
Or9k2
Name: olfactory receptor family 9 subfamily K member 2
Synonyms: GA_x6K02T2PULF-11834065-11833103, Olfr825, MOR210-1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258672
Homologene: 121503
Pde2a
Name: phosphodiesterase 2A, cGMP-stimulated
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207728
HGNC: HGNC:8777
Homologene: 1952
Dcun1d2
Name: defective in cullin neddylation 1 domain containing 2
Synonyms: DCN1, defective in cullin neddylation 1, domain containing 2 (S. cerevisiae)
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102323
Homologene: 85990
Otub1
Name: OTU domain, ubiquitin aldehyde binding 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107260
Homologene: 9772
Or14j6
Name: olfactory receptor family 14 subfamily J member 6
Synonyms: Olfr127, MOR218-7, GA_x6K02T2PSCP-2354126-2355093
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258374
Homologene: 134080
Ciart
Name: circadian associated repressor of transcription
Synonyms: Gm129, LOC229599
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229599
Homologene: 79670
Krtap10-22
Name: keratin associated protein 10-22
Synonyms: Gm3238
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100041261
VEGA: 10
Homologene: 115744
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 90,803,661 bp
  • A to G, chromosome 1 at 156,446,610 bp
  • T to A, chromosome 2 at 57,290,008 bp
  • T to A, chromosome 2 at 89,249,308 bp
  • TCTCCTC to TCTC, chromosome 2 at 121,439,456 bp
  • T to C, chromosome 2 at 129,209,121 bp
  • T to C, chromosome 2 at 144,255,562 bp
  • T to C, chromosome 2 at 168,182,532 bp
  • T to A, chromosome 3 at 60,086,741 bp
  • T to A, chromosome 3 at 89,343,886 bp
  • G to A, chromosome 3 at 95,881,344 bp
  • A to G, chromosome 3 at 101,582,049 bp
  • A to T, chromosome 3 at 117,838,934 bp
  • T to A, chromosome 3 at 129,690,837 bp
  • T to C, chromosome 4 at 94,827,670 bp
  • A to T, chromosome 4 at 118,690,209 bp
  • A to T, chromosome 4 at 135,452,398 bp
  • T to A, chromosome 5 at 16,561,061 bp
  • T to A, chromosome 5 at 21,620,718 bp
  • A to T, chromosome 5 at 87,092,393 bp
  • A to G, chromosome 5 at 100,037,920 bp
  • G to A, chromosome 5 at 108,652,468 bp
  • A to T, chromosome 5 at 110,693,251 bp
  • A to C, chromosome 5 at 115,251,379 bp
  • G to A, chromosome 5 at 121,321,398 bp
  • T to A, chromosome 5 at 149,750,500 bp
  • T to C, chromosome 6 at 3,375,549 bp
  • A to T, chromosome 6 at 34,886,882 bp
  • A to G, chromosome 6 at 47,890,718 bp
  • C to T, chromosome 6 at 118,384,258 bp
  • G to A, chromosome 6 at 124,517,725 bp
  • A to G, chromosome 7 at 24,384,079 bp
  • A to G, chromosome 7 at 45,996,665 bp
  • A to G, chromosome 7 at 83,646,559 bp
  • A to G, chromosome 7 at 101,421,971 bp
  • G to T, chromosome 7 at 104,860,931 bp
  • A to G, chromosome 7 at 120,361,396 bp
  • C to T, chromosome 7 at 127,393,324 bp
  • G to A, chromosome 7 at 131,108,459 bp
  • G to A, chromosome 7 at 140,923,255 bp
  • T to C, chromosome 8 at 13,261,396 bp
  • T to A, chromosome 8 at 23,237,021 bp
  • T to C, chromosome 8 at 69,765,978 bp
  • T to C, chromosome 8 at 70,074,322 bp
  • C to T, chromosome 8 at 104,231,172 bp
  • T to G, chromosome 8 at 106,742,358 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to C, chromosome 8 at 125,768,301 bp
  • A to G, chromosome 9 at 45,945,730 bp
  • A to G, chromosome 9 at 108,956,695 bp
  • T to C, chromosome 10 at 62,429,503 bp
  • A to C, chromosome 10 at 62,625,143 bp
  • A to T, chromosome 10 at 62,879,080 bp
  • T to C, chromosome 10 at 77,770,640 bp
  • A to G, chromosome 10 at 84,533,635 bp
  • A to C, chromosome 10 at 88,752,948 bp
  • T to A, chromosome 10 at 94,579,216 bp
  • C to T, chromosome 10 at 127,574,455 bp
  • T to C, chromosome 10 at 130,163,047 bp
  • T to C, chromosome 11 at 7,210,104 bp
  • A to G, chromosome 11 at 29,824,450 bp
  • A to T, chromosome 11 at 59,503,584 bp
  • A to T, chromosome 11 at 77,845,401 bp
  • T to C, chromosome 11 at 94,416,512 bp
  • G to T, chromosome 11 at 96,770,674 bp
  • A to G, chromosome 11 at 118,050,367 bp
  • C to T, chromosome 12 at 30,006,602 bp
  • T to C, chromosome 12 at 81,734,114 bp
  • A to G, chromosome 13 at 23,481,888 bp
  • T to C, chromosome 13 at 46,815,304 bp
  • A to G, chromosome 13 at 74,172,152 bp
  • A to G, chromosome 13 at 108,324,059 bp
  • A to T, chromosome 14 at 18,008,645 bp
  • T to A, chromosome 14 at 30,963,951 bp
  • A to G, chromosome 14 at 32,662,661 bp
  • A to T, chromosome 14 at 55,710,534 bp
  • T to C, chromosome 14 at 78,512,922 bp
  • CAGCTGGAGGAGC to CAGC, chromosome 15 at 78,436,913 bp
  • C to T, chromosome 15 at 83,659,088 bp
  • T to C, chromosome 15 at 102,716,324 bp
  • A to C, chromosome 16 at 30,354,297 bp
  • T to A, chromosome 16 at 45,244,249 bp
  • A to G, chromosome 17 at 12,423,732 bp
  • A to G, chromosome 17 at 37,904,359 bp
  • A to G, chromosome 17 at 43,039,899 bp
  • A to T, chromosome 17 at 46,919,966 bp
  • T to C, chromosome 17 at 87,334,328 bp
  • A to C, chromosome 18 at 6,992,784 bp
  • A to T, chromosome 18 at 57,667,331 bp
  • A to C, chromosome 19 at 3,370,849 bp
  • A to T, chromosome 19 at 7,204,429 bp
  • A to G, chromosome 19 at 11,304,615 bp
  • T to A, chromosome 19 at 44,015,803 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8098 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067530-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.