Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8111Btlr/Mmmh
Stock Number:
067540-MU
Citation ID:
RRID:MMRRC_067540-MU
Other Names:
R8111 (G1)
Major Collection:

Strain Information

Bpifb3
Name: BPI fold containing family B, member 3
Synonyms: Rya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 378700
Homologene: 18807
Dlg1
Name: discs large MAGUK scaffold protein 1
Synonyms: B130052P05Rik, SAP97, Dlgh1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13383
HGNC: HGNC:2900
Homologene: 20869
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Ppp2r3c
Name: protein phosphatase 2, regulatory subunit B'', gamma
Synonyms: 5730412A08Rik, G4-1, G5pr, 4930511A21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 59032
VEGA: 12
Homologene: 9915
Zfp553
Name: zinc finger protein 553
Synonyms: C330013F15Rik, 2600009K23Rik, ENSMUSG00000054461
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233887
Homologene: 27098
Dclre1c
Name: DNA cross-link repair 1C
Synonyms: 9930121L06Rik, Artemis, Art
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227525
Homologene: 32547
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Apob
Name: apolipoprotein B
Synonyms: apob-100, apob-48
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238055
HGNC: HGNC:603
Homologene: 328
Atp2b1
Name: ATPase, Ca++ transporting, plasma membrane 1
Synonyms: PMCA1, E130111D10Rik, 2810442I22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67972
VEGA: 10
HGNC: HGNC:814
Homologene: 55597
Atf7
Name: activating transcription factor 7
Synonyms: C130020M04Rik, 1110012F10Rik, 9430065F09Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223922
HGNC: HGNC:792
Homologene: 4994
Fuca2
Name: fucosidase, alpha-L- 2, plasma
Synonyms: 5530401P20Rik, 0610025O11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66848
HGNC: HGNC:4008
Homologene: 119
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, DHC2, 4432416O06Rik, D330044F14Rik, D030010H02Rik, Dnchc2, b2b414Clo, m407Asp, m152Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Fat1
Name: FAT atypical cadherin 1
Synonyms: mFat1, 2310038E12Rik, Fath
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14107
HGNC: HGNC:3595
Homologene: 66302
Chd1l
Name: chromodomain helicase DNA binding protein 1-like
Synonyms: Snf2p, 4432404A22Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68058
HGNC: HGNC:1916
Homologene: 11590
Dync2i2
Name: dynein 2 intermediate chain 2
Synonyms: 3200002I06Rik, Wdr34
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71820
Homologene: 14156
Eml5
Name: echinoderm microtubule associated protein like 5
Synonyms: C130068M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319670
VEGA: 12
Homologene: 26807
Mex3a
Name: mex3 RNA binding family member A
Synonyms: Rkhd4, 2700083E18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72640
Homologene: 18950
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Hgsnat
Name: heparan-alpha-glucosaminide N-acetyltransferase
Synonyms: 9430010M12Rik, D8Ertd354e, Tmem76
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 52120
Homologene: 15586
Armc3
Name: armadillo repeat containing 3
Synonyms: 4921513G22Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 70882
Homologene: 31589
Gm10800
Name: predicted gene 10800
Type: Gene
Species: Mouse
Chromosome: 2
Epas1
Name: endothelial PAS domain protein 1
Synonyms: MOP2, HIF-2alpha, Hif like protein, hypoxia inducible transcription factor 2alpha, HLF, HRF, HIF2A, bHLHe73
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 13819
VEGA: 17
HGNC: HGNC:3374
Homologene: 1095
Ap3b2
Name: adaptor-related protein complex 3, beta 2 subunit
Synonyms: Naptb, beta3B
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11775
HGNC: HGNC:567
Homologene: 55837
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Atg9a
Name: autophagy related 9A
Synonyms: Apg9l1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 245860
Homologene: 34495
Pappa
Name: pregnancy-associated plasma protein A
Synonyms: PAG1, IGFBP-4ase, PAPP-A, 8430414N03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18491
HGNC: HGNC:8602
Homologene: 31097
Gpat2
Name: glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms: Gpat2, A530057A03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215456
Homologene: 19037
Sfi1
Name: Sfi1 homolog, spindle assembly associated (yeast)
Synonyms: 2310047I15Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78887
Homologene: 12707
Itih1
Name: inter-alpha trypsin inhibitor, heavy chain 1
Synonyms: inter-alpha (globulin) inhibitor, H1 polypeptide, Intin1, Itih-1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16424
HGNC: HGNC:6166
Homologene: 1667
Gmcl1
Name: germ cell-less, spermatogenesis associated 1
Synonyms: mglc-1, 2810049L19Rik, Gcl, Btbd13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23885
Homologene: 8021
Prss37
Name: serine protease 37
Synonyms: 1700016G05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67690
Homologene: 12174
3425401B19Rik
Name: RIKEN cDNA 3425401B19 gene
Synonyms: CEFIP
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100504518
VEGA: 14
Homologene: 54908
Ccdc57
Name: coiled-coil domain containing 57
Synonyms: 4933434G05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71276
Homologene: 52351
Otulin
Name: OTU deubiquitinase with linear linkage specificity
Synonyms: m7-1Sapc, gumby, m3Sapc, Fam105b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 432940
VEGA: 15
Homologene: 106591
Washc1
Name: WASH complex subunit 1
Synonyms: 1110049F14Rik, ORF19, Wash, Wash1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68767
VEGA: 17
Homologene: 45706
Gpr137b
Name: G protein-coupled receptor 137B
Synonyms: C80741, 2310041G17Rik, Tm7sf1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 83924
VEGA: 13
Homologene: 2454
Adam29
Name: a disintegrin and metallopeptidase domain 29
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244486
HGNC: HGNC:207
Homologene: 8607
Obox5
Name: oocyte specific homeobox 5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 252829
Homologene: 44937
Hivep3
Name: human immunodeficiency virus type I enhancer binding protein 3
Synonyms: Krc, E030045D18Rik, 2900056N03Rik, Shn3, Schnurri-3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16656
Homologene: 7803
Lrriq4
Name: leucine-rich repeats and IQ motif containing 4
Synonyms: 4930558O21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68307
Homologene: 12260
Ano3
Name: anoctamin 3
Synonyms: B230324K02Rik, Tmem16c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228432
Homologene: 57147
Iffo1
Name: intermediate filament family orphan 1
Synonyms: 4733401N06Rik, Iffo, A930037G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320678
Homologene: 18706
Adamts5
Name: ADAM metallopeptidase with thrombospondin type 1 motif 5
Synonyms: ADAM-TS5, 9530092O11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 23794
VEGA: 16
HGNC: HGNC:221
Homologene: 5109
Tmem132b
Name: transmembrane protein 132B
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 208151
Homologene: 28135
Spire1
Name: spire type actin nucleation factor 1
Synonyms: Spir-1, 6030430B19Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68166
VEGA: 18
Homologene: 35507
Hs3st2
Name: heparan sulfate (glucosamine) 3-O-sulfotransferase 2
Synonyms: 6430516N12Rik, A830061E14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 195646
HGNC: HGNC:5195
Homologene: 21220
Zfp9
Name: zinc finger protein 9
Synonyms: Krox-4, Zfp-9, 1810048F22Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22750
Homologene: 49280
4930590J08Rik
Name: RIKEN cDNA 4930590J08 gene
Synonyms: LOC381798
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381798
Homologene: 49985
Mgat4d
Name: MGAT4 family, member C
Synonyms: 4933434I20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 67555
Homologene: 128538
Mmp24
Name: matrix metallopeptidase 24
Synonyms: MT5-MMP, Membrane type 5-MMP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17391
HGNC: HGNC:7172
Homologene: 21331
Cacna1f
Name: calcium channel, voltage-dependent, alpha 1F subunit
Synonyms: Sfc17, Cav1.4
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 54652
HGNC: HGNC:1393
Homologene: 74542
8030423J24Rik
Name: RIKEN cDNA 8030423J24 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 77166
VEGA: 13
Or10g3b
Name: olfactory receptor family 10 subfamily G member 3B
Synonyms: GA_x6K02T2RJGY-644134-645075, MOR223-7P, MOR223-10, Olfr1513, MOR30B
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258008
HGNC: HGNC:8171
Homologene: 79404
Npffr1
Name: neuropeptide FF receptor 1
Synonyms: LOC237362, NPFF1, Gpr147, NPFF1R
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237362
Homologene: 23348
Sike1
Name: suppressor of IKBKE 1
Synonyms: 2810005O12Rik, 5730470L24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66641
Homologene: 32622
Gm11110
Name: predicted gene 11110
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100169874
VEGA: 17
Sgo2b
Name: shugoshin 2B
Synonyms: Gm4975, Sgol2b
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244495
Homologene: 51867
Gm6176
Name: predicted gene 6176
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620736
Homologene: 128656
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 75,187,722 bp
  • T to A, chromosome 2 at 3,447,148 bp
  • T to C, chromosome 2 at 19,296,863 bp
  • C to A, chromosome 2 at 30,031,847 bp
  • CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA to CAAGAAAACTGAAAATCA, chromosome 2 at 98,667,016 bp
  • T to C, chromosome 2 at 110,783,713 bp
  • G to T, chromosome 2 at 127,433,857 bp
  • A to C, chromosome 2 at 153,922,689 bp
  • T to A, chromosome 2 at 155,807,425 bp
  • T to C, chromosome 3 at 30,655,781 bp
  • C to A, chromosome 3 at 86,327,705 bp
  • T to C, chromosome 3 at 88,536,757 bp
  • C to T, chromosome 3 at 97,587,210 bp
  • T to C, chromosome 3 at 103,001,807 bp
  • T to A, chromosome 4 at 32,674,003 bp
  • A to G, chromosome 4 at 65,261,992 bp
  • T to A, chromosome 4 at 120,098,386 bp
  • A to G, chromosome 5 at 125,622,793 bp
  • T to C, chromosome 6 at 40,517,813 bp
  • G to T, chromosome 6 at 86,721,426 bp
  • A to G, chromosome 6 at 91,917,710 bp
  • G to A, chromosome 6 at 118,464,600 bp
  • T to C, chromosome 6 at 125,145,818 bp
  • T to A, chromosome 7 at 15,758,616 bp
  • T to A, chromosome 7 at 22,051,168 bp
  • A to G, chromosome 7 at 81,463,782 bp
  • A to T, chromosome 7 at 121,393,139 bp
  • T to A, chromosome 7 at 127,236,921 bp
  • C to T, chromosome 8 at 15,917,306 bp
  • C to T, chromosome 8 at 25,968,412 bp
  • G to A, chromosome 8 at 45,026,058 bp
  • T to G, chromosome 8 at 55,871,550 bp
  • T to A, chromosome 8 at 63,943,104 bp
  • A to T, chromosome 8 at 83,368,147 bp
  • T to C, chromosome 9 at 7,148,688 bp
  • T to A, chromosome 9 at 18,592,629 bp
  • T to C, chromosome 10 at 13,514,801 bp
  • T to A, chromosome 10 at 61,623,349 bp
  • T to C, chromosome 10 at 98,996,924 bp
  • TCGC to TC, chromosome 11 at 3,146,254 bp
  • T to A, chromosome 11 at 120,878,887 bp
  • G to A, chromosome 12 at 8,008,801 bp
  • C to A, chromosome 12 at 55,297,849 bp
  • A to G, chromosome 12 at 98,792,514 bp
  • T to C, chromosome 13 at 13,359,406 bp
  • T to A, chromosome 13 at 70,883,958 bp
  • T to C, chromosome 14 at 30,932,268 bp
  • C to T, chromosome 14 at 32,660,309 bp
  • G to A, chromosome 14 at 52,349,887 bp
  • G to A, chromosome 15 at 12,373,506 bp
  • A to C, chromosome 15 at 27,606,295 bp
  • G to T, chromosome 15 at 102,563,334 bp
  • C to T, chromosome 16 at 31,842,802 bp
  • A to G, chromosome 16 at 85,899,315 bp
  • T to C, chromosome 17 at 30,971,818 bp
  • A to C, chromosome 17 at 57,103,427 bp
  • C to G, chromosome 17 at 66,116,038 bp
  • C to A, chromosome 17 at 86,818,432 bp
  • A to G, chromosome 18 at 67,519,321 bp
  • G to T, chromosome X at 7,621,087 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8111 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067540-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.