Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8136Btlr/Mmmh
Stock Number:
067564-MU
Citation ID:
RRID:MMRRC_067564-MU
Other Names:
R8136 (G1)
Major Collection:

Strain Information

Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Esyt2
Name: extended synaptotagmin-like protein 2
Synonyms: 2410017M09Rik, 4921504I16Rik, 2310058N22Rik, D12Ertd551e, Fam62b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 52635
VEGA: 12
Homologene: 32699
Wls
Name: wntless WNT ligand secretion mediator
Synonyms: 5031439A09Rik, Gpr177
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68151
Homologene: 11779
Emc2
Name: ER membrane protein complex subunit 2
Synonyms: 4921531G14Rik, Ttc35
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66736
VEGA: 15
Homologene: 8785
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Itpr-1, Ip3r, Pcp-1, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Skic3
Name: SKI3 subunit of superkiller complex
Synonyms: Ttc37
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Mcm9
Name: minichromosome maintenance 9 homologous recombination repair factor
Synonyms: 9030408O17Rik, Mcmdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71567
VEGA: 10
Homologene: 13546
Ubr3
Name: ubiquitin protein ligase E3 component n-recognin 3
Synonyms: 4833421P10Rik, A130030D10Rik, 1110059H15Rik, Zfp650
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68795
Homologene: 52092
Aptx
Name: aprataxin
Synonyms: 2410016G21Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66408
Homologene: 41634
Mfsd2a
Name: MFSD2 lysolipid transporter A, lysophospholipid
Synonyms: major facilitator superfamily domain containing 2A, 1700018O18Rik, Mfsd2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76574
Homologene: 19229
Sppl2a
Name: signal peptide peptidase like 2A
Synonyms: C130089K23Rik, 2010106G01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66552
Homologene: 36411
Or51a6
Name: olfactory receptor family 51 subfamily A member 6
Synonyms: GA_x6K02T2PBJ9-5666843-5665908, MOR8-1, Olfr575
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259118
Homologene: 122786
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: D7Ertd565e, Nalp9a, Nalp-theta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Sdk2
Name: sidekick cell adhesion molecule 2
Synonyms: 4632412F08Rik, 5330435L01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237979
Homologene: 10406
Btnl1
Name: butyrophilin-like 1
Synonyms: NG10, LOC240074, LOC240074, Btnl3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100038862
Homologene: 103816
Tnn
Name: tenascin N
Synonyms: Tnw, tenascin-W
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329278
Homologene: 18634
Bmpr1b
Name: bone morphogenetic protein receptor, type 1B
Synonyms: Alk6, CFK-43a, Acvrlk6, BMPR-IB
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12167
HGNC: HGNC:1077
Homologene: 20322
Treml4
Name: triggering receptor expressed on myeloid cells-like 4
Synonyms: 5031403H21Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224840
Vrtn
Name: vertebrae development associated
Synonyms: 7420416P09Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 432677
VEGA: 12
Homologene: 41236
Gatm
Name: glycine amidinotransferase (L-arginine:glycine amidinotransferase)
Synonyms: 1810003P21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67092
HGNC: HGNC:4175
Homologene: 1136
Pcnx1
Name: pecanex 1
Synonyms: 3526401J03Rik, 2900024E21Rik, Pcnx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
Zfp217
Name: zinc finger protein 217
Synonyms: 4933431C08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228913
Homologene: 4757
Map3k19
Name: mitogen-activated protein kinase kinase kinase 19
Synonyms: Ysk4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22625
Homologene: 19318
Crygn
Name: crystallin, gamma N
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 214301
Homologene: 16986
Cyp26a1
Name: cytochrome P450, family 26, subfamily a, polypeptide 1
Synonyms: P450RAI, P450RA, retinoic acid hydrolase, RAH, Cyp26
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13082
VEGA: 19
HGNC: HGNC:2603
Homologene: 37349
Zfp777
Name: zinc finger protein 777
Synonyms: 2500002G23Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72306
Homologene: 56721
Zfp39
Name: zinc finger protein 39
Synonyms: CTfin33, Zfp-39
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22698
Homologene: 69102
Slc22a2
Name: solute carrier family 22 (organic cation transporter), member 2
Synonyms: Oct2, Orct2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20518
VEGA: 17
Homologene: 68293
Phf11a
Name: PHD finger protein 11A
Synonyms: 4933417L10Rik, Phf11
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219131
Homologene: 87807
Krtap4-1
Name: keratin associated protein 4-1
Synonyms: A030010K20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 665891
Rab3c
Name: RAB3C, member RAS oncogene family
Synonyms: 2700062I01Rik, 3110037E15Rik, 3110015B08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67295
VEGA: 13
Homologene: 23420
Gpr65
Name: G-protein coupled receptor 65
Synonyms: TDAG8, Gpcr25, Dig1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14744
VEGA: 12
HGNC: HGNC:4517
Homologene: 2675
Garin5a
Name: golgi associated RAB2 interactor 5A
Synonyms: 0610007G24Rik, 1700021N13Rik, 1700021P22Rik, Fam71e1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75538
Homologene: 19259
Wipf1
Name: WAS/WASL interacting protein family, member 1
Synonyms: WIP, D2Ertd120e, Waspip
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215280
Homologene: 86891
Pigb
Name: phosphatidylinositol glycan anchor biosynthesis, class B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 55981
HGNC: HGNC:8959
Homologene: 3570
Peds1
Name: plasmanylethanolamine desaturase 1
Synonyms: Tmem189
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 407243
Homologene: 33615
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 71,248,397 bp
  • A to C, chromosome 1 at 127,823,755 bp
  • T to A, chromosome 1 at 160,107,060 bp
  • T to C, chromosome 2 at 70,021,179 bp
  • G to A, chromosome 2 at 73,437,535 bp
  • T to C, chromosome 2 at 122,595,537 bp
  • T to C, chromosome 2 at 126,913,281 bp
  • A to C, chromosome 2 at 167,644,959 bp
  • G to A, chromosome 2 at 170,119,651 bp
  • G to A, chromosome 3 at 98,124,221 bp
  • A to G, chromosome 3 at 141,856,382 bp
  • C to A, chromosome 3 at 159,873,124 bp
  • A to G, chromosome 4 at 40,688,107 bp
  • T to A, chromosome 4 at 63,283,953 bp
  • A to T, chromosome 4 at 122,951,867 bp
  • G to T, chromosome 5 at 24,751,092 bp
  • C to A, chromosome 6 at 48,044,625 bp
  • A to G, chromosome 6 at 108,438,360 bp
  • T to G, chromosome 7 at 26,557,253 bp
  • T to C, chromosome 7 at 44,500,280 bp
  • A to T, chromosome 7 at 102,955,241 bp
  • A to G, chromosome 9 at 73,022,320 bp
  • A to G, chromosome 10 at 53,611,343 bp
  • A to T, chromosome 11 at 58,891,402 bp
  • GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC to GGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGCTGCAGCAAGGGCTGCAGCAGGGGC, chromosome 11 at 99,627,834 bp
  • G to A, chromosome 11 at 113,851,713 bp
  • A to G, chromosome 12 at 81,918,006 bp
  • C to T, chromosome 12 at 84,650,035 bp
  • T to C, chromosome 12 at 98,275,156 bp
  • C to A, chromosome 12 at 113,131,678 bp
  • C to A, chromosome 12 at 116,363,459 bp
  • A to G, chromosome 13 at 76,113,103 bp
  • A to T, chromosome 13 at 110,181,020 bp
  • A to G, chromosome 14 at 59,277,569 bp
  • A to G, chromosome 15 at 43,511,806 bp
  • C to T, chromosome 17 at 12,606,030 bp
  • T to A, chromosome 17 at 34,380,040 bp
  • C to A, chromosome 17 at 48,264,717 bp
  • T to C, chromosome 19 at 37,701,206 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8136 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067564-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.