Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8212Btlr/Mmmh
Stock Number:
067635-MU
Citation ID:
RRID:MMRRC_067635-MU
Other Names:
R8212 (G1)
Major Collection:

Strain Information

Cfdp1
Name: craniofacial development protein 1
Synonyms: cp27, Bucentaur, Bcnt
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23837
HGNC: HGNC:1873
Homologene: 4611
Pcf11
Name: PCF11 cleavage and polyadenylation factor subunit
Synonyms: 5730417B17Rik, 2500001H09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74737
Homologene: 32282
Trnt1
Name: tRNA nucleotidyl transferase, CCA-adding, 1
Synonyms: 2610044E04Rik, CGI-47, 2410043H24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 70047
Homologene: 9333
Gria4
Name: glutamate receptor, ionotropic, AMPA4 (alpha 4)
Synonyms: Glur-4, Glur4, spkw1, Gluralpha4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 14802
HGNC: HGNC:4574
Homologene: 20227
Ube2o
Name: ubiquitin-conjugating enzyme E2O
Synonyms: B230113M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217342
Homologene: 11113
Foxo3
Name: forkhead box O3
Synonyms: FKHRL1, Fkhr2, 2010203A17Rik, 1110048B16Rik, Foxo3a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56484
HGNC: HGNC:3821
Homologene: 31039
Cpne1
Name: copine I
Synonyms: 1810028N16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 266692
HGNC: HGNC:2314
Homologene: 36501
Cstf1
Name: cleavage stimulation factor, 3' pre-RNA, subunit 1
Synonyms: 1700057K18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 67337
HGNC: HGNC:2483
Homologene: 1012
Heatr5a
Name: HEAT repeat containing 5A
Synonyms: D930036F22Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320487
VEGA: 12
Homologene: 19635
Tm9sf3
Name: transmembrane 9 superfamily member 3
Synonyms: 2810031D16Rik, 1810073M23Rik, Smbp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107358
VEGA: 19
Homologene: 10588
Zfhx2
Name: zinc finger homeobox 2
Synonyms: zfh-5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239102
Homologene: 52657
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pkhd1l1
Name: polycystic kidney and hepatic disease 1-like 1
Synonyms: D86 mRNA, PKHDL1, fibrocystin L
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 192190
Homologene: 16332
Plb1
Name: phospholipase B1
Synonyms: 4632413E21Rik, 4930433E17Rik, 4930539A06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665270
Homologene: 82108
Cfap126
Name: cilia and flagella associated protein 126
Synonyms: Fltp, Flattop, 1700009P17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75472
Homologene: 23682
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Plekhs1
Name: pleckstrin homology domain containing, family S member 1
Synonyms: 9930023K05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226245
VEGA: 19
Homologene: 11770
Or8b54
Name: olfactory receptor family 8 subfamily B member 54
Synonyms: GA_x6K02T2PVTD-32478047-32478988, MOR165-8, Olfr921
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258778
VEGA: 9
Homologene: 128138
Gm5114
Name: predicted gene 5114
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330513
Homologene: 45597
Rbm46
Name: RNA binding motif protein 46
Synonyms: LOC329687, ENSMUSG00000033882
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 633285
Homologene: 17016
Ppef2
Name: protein phosphatase, EF hand calcium-binding domain 2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19023
HGNC: HGNC:9244
Homologene: 55959
Slc2a9
Name: solute carrier family 2 (facilitated glucose transporter), member 9
Synonyms: Glut9, SLC2A9B, SLC2a9A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 117591
Homologene: 69290
Clpx
Name: caseinolytic mitochondrial matrix peptidase chaperone subunit
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270166
HGNC: HGNC:2088
Homologene: 4851
Cfap45
Name: cilia and flagella associated protein 45
Synonyms: 1700028D05Rik, Nesg1, Ccdc19
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71870
Homologene: 71837
Zfp616
Name: zinc finger protein 616
Synonyms: Gm12330
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327963
Homologene: 88945
Fam83c
Name: family with sequence similarity 83, member C
Synonyms: 5530400B04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71405
Homologene: 18669
Sry
Name: sex determining region of Chr Y
Synonyms: Tdf, Tdy
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 21674
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Op1, Mater, Nalp5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23968
Homologene: 65105
Cobll1
Name: Cobl-like 1
Synonyms: Coblr1, D430044D16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319876
Homologene: 8933
Galnt6
Name: polypeptide N-acetylgalactosaminyltransferase 6
Synonyms: GalNAc-T6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 207839
HGNC: HGNC:4128
Homologene: 5218
Slc36a3
Name: solute carrier family 36 (proton/amino acid symporter), member 3
Synonyms: tramdorin2, PAT3, TRAMD2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 215332
Homologene: 76175
Arl2
Name: ADP-ribosylation factor-like 2
Synonyms: arf-like protein 2, 2610009M23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56327
HGNC: HGNC:693
Homologene: 1260
Polr2h
Name: polymerase (RNA) II (DNA directed) polypeptide H
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 245841
HGNC: HGNC:9195
Homologene: 4540
Ager
Name: advanced glycosylation end product-specific receptor
Synonyms: RAGE
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 11596
HGNC: HGNC:320
Homologene: 883
Sppl2b
Name: signal peptide peptidase like 2B
Synonyms: 3110056O03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73218
VEGA: 10
Homologene: 10605
Cyp2a22
Name: cytochrome P450, family 2, subfamily a, polypeptide 22
Synonyms: EG233005
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233005
Homologene: 69128
Or14j6
Name: olfactory receptor family 14 subfamily J member 6
Synonyms: MOR218-7, GA_x6K02T2PSCP-2354126-2355093, Olfr127
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258374
Homologene: 134080
Rwdd1
Name: RWD domain containing 1
Synonyms: 2700069A07Rik, 2610002D06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66521
Homologene: 41082
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 71,642,905 bp
  • A to T, chromosome 1 at 171,126,061 bp
  • A to G, chromosome 1 at 172,541,500 bp
  • T to C, chromosome 2 at 65,102,080 bp
  • T to A, chromosome 2 at 76,782,282 bp
  • A to G, chromosome 2 at 155,829,287 bp
  • T to C, chromosome 2 at 156,078,214 bp
  • T to C, chromosome 2 at 172,377,952 bp
  • C to T, chromosome 3 at 82,865,468 bp
  • T to C, chromosome 4 at 43,555,918 bp
  • T to C, chromosome 5 at 32,264,906 bp
  • G to T, chromosome 5 at 38,480,059 bp
  • T to A, chromosome 5 at 92,228,665 bp
  • T to C, chromosome 6 at 106,769,871 bp
  • A to T, chromosome 7 at 23,417,337 bp
  • T to C, chromosome 7 at 26,937,780 bp
  • A to G, chromosome 7 at 39,411,252 bp
  • G to A, chromosome 7 at 92,659,498 bp
  • A to T, chromosome 8 at 111,845,183 bp
  • G to A, chromosome 9 at 4,480,242 bp
  • G to A, chromosome 9 at 38,775,281 bp
  • A to G, chromosome 9 at 65,320,891 bp
  • A to G, chromosome 10 at 34,002,527 bp
  • T to C, chromosome 10 at 42,196,995 bp
  • T to A, chromosome 10 at 80,865,359 bp
  • T to A, chromosome 11 at 55,125,081 bp
  • T to A, chromosome 11 at 74,085,743 bp
  • A to G, chromosome 11 at 116,548,798 bp
  • C to A, chromosome 12 at 51,899,229 bp
  • T to C, chromosome 13 at 81,522,121 bp
  • G to T, chromosome 14 at 55,072,916 bp
  • A to G, chromosome 15 at 44,499,300 bp
  • T to C, chromosome 15 at 100,693,427 bp
  • T to C, chromosome 16 at 20,717,996 bp
  • G to A, chromosome 17 at 34,600,612 bp
  • T to C, chromosome 17 at 37,904,257 bp
  • G to T, chromosome 19 at 6,137,566 bp
  • A to T, chromosome 19 at 41,240,635 bp
  • A to G, chromosome 19 at 56,471,756 bp
  • GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG to GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG, chromosome Y at 2,662,638 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8212 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067635-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.