Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8249Btlr/Mmmh
Stock Number:
067649-MU
Citation ID:
RRID:MMRRC_067649-MU
Other Names:
R8249 (G1)
Major Collection:

Strain Information

Kit
Name: Kit proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Pi4k2a
Name: phosphatidylinositol 4-kinase type 2 alpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 84095
VEGA: 19
Homologene: 101681
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Adck2
Name: aarF domain containing kinase 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 57869
Homologene: 49103
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Arhgap12
Name: Rho GTPase activating protein 12
Synonyms: 2810011M08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 75415
Homologene: 23089
Gcfc2
Name: GC-rich sequence DNA binding factor 2
Synonyms: AW146020
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330361
HGNC: HGNC:1317
Homologene: 2411
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 58,534,637 bp
  • A to T, chromosome 1 at 66,619,491 bp
  • A to G, chromosome 1 at 71,321,812 bp
  • A to T, chromosome 1 at 150,819,366 bp
  • A to T, chromosome 1 at 162,477,743 bp
  • G to A, chromosome 2 at 90,797,564 bp
  • C to G, chromosome 2 at 158,000,715 bp
  • A to T, chromosome 3 at 88,058,388 bp
  • C to T, chromosome 3 at 126,797,729 bp
  • C to A, chromosome 4 at 34,750,955 bp
  • T to G, chromosome 4 at 58,368,926 bp
  • T to C, chromosome 4 at 106,721,212 bp
  • G to A, chromosome 4 at 107,178,993 bp
  • A to C, chromosome 5 at 3,891,550 bp
  • T to A, chromosome 5 at 65,075,626 bp
  • T to C, chromosome 5 at 72,605,394 bp
  • T to C, chromosome 5 at 75,641,408 bp
  • A to G, chromosome 5 at 135,349,952 bp
  • A to T, chromosome 5 at 142,188,015 bp
  • C to A, chromosome 6 at 18,030,285 bp
  • C to T, chromosome 6 at 39,585,733 bp
  • A to G, chromosome 6 at 41,151,998 bp
  • T to C, chromosome 6 at 81,956,951 bp
  • T to A, chromosome 7 at 26,375,353 bp
  • GC to GCCAGGGGAGGTGAGCGGTGGGTCACCTCCC, chromosome 7 at 30,359,873 bp
  • G to T, chromosome 7 at 139,254,843 bp
  • T to A, chromosome 9 at 119,617,774 bp
  • C to A, chromosome 10 at 127,605,543 bp
  • T to A, chromosome 11 at 16,953,433 bp
  • T to C, chromosome 11 at 100,086,722 bp
  • C to T, chromosome 11 at 115,253,837 bp
  • T to C, chromosome 12 at 81,780,777 bp
  • C to T, chromosome 12 at 103,693,768 bp
  • T to C, chromosome 12 at 116,000,224 bp
  • T to C, chromosome 14 at 31,665,948 bp
  • C to A, chromosome 14 at 79,401,479 bp
  • T to A, chromosome 17 at 36,549,008 bp
  • G to T, chromosome 17 at 50,047,380 bp
  • A to T, chromosome 18 at 6,027,635 bp
  • C to T, chromosome 18 at 25,339,718 bp
  • A to T, chromosome 18 at 36,788,001 bp
  • T to C, chromosome 19 at 8,846,520 bp
  • T to A, chromosome 19 at 34,640,989 bp
  • A to G, chromosome 19 at 42,115,062 bp
  • C to A, chromosome X at 96,714,017 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8249 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067649-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.