Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8217Btlr/Mmmh
Stock Number:
067658-MU
Citation ID:
RRID:MMRRC_067658-MU
Other Names:
R8217 (G1)
Major Collection:

Strain Information

Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Pola2
Name: polymerase (DNA directed), alpha 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18969
VEGA: 19
Homologene: 48121
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Mtmr12
Name: myotubularin related protein 12
Synonyms: C730015A02Rik, Pip3ap
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268783
Homologene: 10403
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 14,887,023 bp
  • CTTTT to CTTTTT, chromosome 1 at 130,419,600 bp
  • GGTGTG to GGTGTGTG, chromosome 1 at 171,463,088 bp
  • T to A, chromosome 2 at 27,922,123 bp
  • C to T, chromosome 2 at 86,236,518 bp
  • T to C, chromosome 2 at 103,279,631 bp
  • C to A, chromosome 3 at 61,365,130 bp
  • A to G, chromosome 3 at 83,838,066 bp
  • A to C, chromosome 3 at 129,855,001 bp
  • A to T, chromosome 3 at 130,040,950 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • A to C, chromosome 5 at 36,614,058 bp
  • T to C, chromosome 5 at 41,831,507 bp
  • A to T, chromosome 5 at 72,764,259 bp
  • A to G, chromosome 5 at 103,867,600 bp
  • G to C, chromosome 5 at 136,697,971 bp
  • A to T, chromosome 5 at 142,211,958 bp
  • T to C, chromosome 6 at 83,103,216 bp
  • T to C, chromosome 6 at 125,060,958 bp
  • A to G, chromosome 6 at 142,275,476 bp
  • T to A, chromosome 7 at 28,368,292 bp
  • A to G, chromosome 7 at 86,466,182 bp
  • T to A, chromosome 7 at 101,992,669 bp
  • T to C, chromosome 8 at 61,329,930 bp
  • A to C, chromosome 8 at 88,664,157 bp
  • A to T, chromosome 8 at 105,363,324 bp
  • A to G, chromosome 8 at 108,950,717 bp
  • G to A, chromosome 9 at 26,756,869 bp
  • T to A, chromosome 9 at 56,890,353 bp
  • C to T, chromosome 9 at 59,678,809 bp
  • T to C, chromosome 9 at 66,779,272 bp
  • T to C, chromosome 9 at 119,954,628 bp
  • A to T, chromosome 11 at 58,580,966 bp
  • A to T, chromosome 12 at 36,208,677 bp
  • GTAGTGTATA to GTA, chromosome 12 at 85,803,148 bp
  • T to A, chromosome 13 at 41,012,650 bp
  • G to T, chromosome 13 at 50,469,723 bp
  • T to C, chromosome 13 at 74,672,818 bp
  • T to C, chromosome 15 at 12,259,640 bp
  • A to T, chromosome 15 at 27,818,969 bp
  • A to G, chromosome 15 at 76,067,155 bp
  • C to A, chromosome 16 at 29,403,801 bp
  • A to G, chromosome 16 at 55,226,932 bp
  • T to C, chromosome 17 at 18,243,724 bp
  • T to A, chromosome 17 at 31,851,312 bp
  • T to C, chromosome 18 at 36,946,921 bp
  • G to C, chromosome 18 at 60,829,051 bp
  • T to A, chromosome 19 at 5,963,827 bp
  • G to T, chromosome 19 at 17,120,116 bp
  • C to T, chromosome 19 at 37,207,811 bp
  • C to T, chromosome 19 at 41,624,520 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8217 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067658-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.