Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8217Btlr/Mmmh
Stock Number:
067658-MU
Citation ID:
RRID:MMRRC_067658-MU
Other Names:
R8217 (G1)
Major Collection:

Strain Information

Slco1a5
Name: solute carrier organic anion transporter family, member 1a5
Synonyms: Oatp3, Slc21a7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108096
Homologene: 56603
Slit1
Name: slit guidance ligand 1
Synonyms: Slil1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20562
Homologene: 2302
Scrib
Name: scribbled planar cell polarity
Synonyms: Scrb1, Crc
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105782
Homologene: 44228
Pola2
Name: polymerase (DNA directed), alpha 2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18969
VEGA: 19
Homologene: 48121
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: 6720401E04Rik, NuMA
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Mtmr12
Name: myotubularin related protein 12
Synonyms: C730015A02Rik, Pip3ap
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268783
Homologene: 10403
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Pkm
Name: pyruvate kinase, muscle
Synonyms: Pk-3, Pk-2, Pk3, Pkm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18746
VEGA: 9
HGNC: HGNC:9021
Homologene: 37650
Tcof1
Name: treacle ribosome biogenesis factor 1
Synonyms: treacle
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21453
Homologene: 68049
Tlr2
Name: toll-like receptor 2
Synonyms: Ly105
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 24088
Homologene: 20695
Trio
Name: triple functional domain (PTPRF interacting)
Synonyms: 6720464I07Rik, Solo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223435
VEGA: 15
Homologene: 20847
Erap1
Name: endoplasmic reticulum aminopeptidase 1
Synonyms: PILSAP, ERAAP, Arts1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 80898
VEGA: 13
Homologene: 56754
B3gat1
Name: beta-1,3-glucuronyltransferase 1
Synonyms: 0710007K08Rik, GlcAT-P
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76898
HGNC: HGNC:921
Homologene: 49551
Bod1l
Name: biorientation of chromosomes in cell division 1-like
Synonyms: A230054D04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665775
Homologene: 45109
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320661
Homologene: 19716
Prune2
Name: prune homolog 2
Synonyms: 6330414G02Rik, A330102H22Rik, A230083H22Rik, Olfaxin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 353211
VEGA: 19
Homologene: 18939
F11r
Name: F11 receptor
Synonyms: BV11 antigen, Ly106, JAM-1, ESTM33, Jcam1, JAM-A
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16456
Homologene: 14255
Sec24b
Name: SEC24 homolog B, COPII coat complex component
Synonyms: SEC24
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99683
Homologene: 55968
Trpa1
Name: transient receptor potential cation channel, subfamily A, member 1
Synonyms: ANKTM1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 277328
HGNC: HGNC:497
Homologene: 7189
Klhl8
Name: kelch-like 8
Synonyms: 2310001P09Rik, D5Ertd431e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 246293
Homologene: 10819
Cfi
Name: complement component factor i
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 12630
HGNC: HGNC:5394
Homologene: 171
Slc9a5
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 5
Synonyms: LOC277973
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 277973
Homologene: 31247
Sh3rf1
Name: SH3 domain containing ring finger 1
Synonyms: Posh, 2200003J05Rik, Sh3md2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 59009
Homologene: 10988
Sik1
Name: salt inducible kinase 1
Synonyms: Msk, Snf1lk
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17691
VEGA: 17
Homologene: 7847
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Ttc21a
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74052
Homologene: 14728
Cspg4
Name: chondroitin sulfate proteoglycan 4
Synonyms: NG2, AN2, 4732461B14Rik, Cspg4a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 121021
VEGA: 9
HGNC: HGNC:2466
Homologene: 20445
Acrbp
Name: proacrosin binding protein
Synonyms: sp32, OY-TES-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54137
Homologene: 9641
Atp13a4
Name: ATPase type 13A4
Synonyms: 4631413J11Rik, 9330174J19Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224079
Homologene: 75330
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Col5a1
Name: collagen, type V, alpha 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12831
HGNC: HGNC:2209
Homologene: 55434
Sdk1
Name: sidekick cell adhesion molecule 1
Synonyms: 6720466O15Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330222
Homologene: 27395
Tec
Name: tec protein tyrosine kinase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21682
Homologene: 1302
Nod2
Name: nucleotide-binding oligomerization domain containing 2
Synonyms: F830032C23Rik, Card15, Nlrc2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 257632
HGNC: HGNC:5331
Homologene: 11156
Zpld1
Name: zona pellucida like domain containing 1
Synonyms: 9430016A21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239852
Homologene: 18401
Pak1ip1
Name: PAK1 interacting protein 1
Synonyms: 5830431I15Rik, 5930415H02Rik, p21-activated protein kinase-interacting protein 1, PIP1, Gdpd1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 68083
Homologene: 39574
Ehf
Name: ets homologous factor
Synonyms: 9030625L19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13661
HGNC: HGNC:3246
Homologene: 7301
Ccdc142
Name: coiled-coil domain containing 142
Synonyms: A230058J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243510
Homologene: 27813
Aph1b
Name: aph1 homolog B, gamma secretase subunit
Synonyms: 2310057K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208117
Homologene: 12844
Or2t46
Name: olfactory receptor family 2 subfamily T member 46
Synonyms: GA_x6K02T2NKPP-844642-843680, MOR275-5, MOR275-11_p, Olfr325
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258261
Homologene: 133015
Marchf5
Name: membrane associated ring-CH-type finger 5
Synonyms: 2310008I22Rik, E130202O05Rik, 1810015H18Rik, MARCH-V, 2700055A20Rik, Rnf153, 5730499H23Rik, MITOL, March5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69104
Homologene: 9862
Or8k17
Name: olfactory receptor family 8 subfamily K member 17
Synonyms: GA_x6K02T2Q125-47716657-47715716, MOR187-2, Olfr1048
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259016
Cd55b
Name: CD55 molecule, decay accelerating factor for complement B
Synonyms: Daf-TM, complement-transmembrane, TM-DAF, Daf2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13137
HGNC: HGNC:2665
Homologene: 479
Plekhg2
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 2
Synonyms: Clg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101497
Homologene: 16341
Or14c43
Name: olfactory receptor family 14 subfamily C member 43
Synonyms: GA_x6K02T2NHDJ-9643949-9642957, MOR221-2, Olfr299
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 257929
Homologene: 115489
Rap2b
Name: RAP2B, member of RAS oncogene family
Synonyms: 4021402C18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74012
HGNC: HGNC:9862
Homologene: 55701
Lrrc72
Name: leucine rich repeat containing 72
Synonyms: 4933421E18Rik, 1700108M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71156
Homologene: 90358
Myl10
Name: myosin, light chain 10, regulatory
Synonyms: PLRLC-C, PLRLC-B, PLRLC-A, PLRLC, 1700027I08Rik, Mylc2pl
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 59310
Homologene: 69341
Pcdha3
Name: protocadherin alpha 3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192163
HGNC: HGNC:8669
Homologene: 129613
Mfsd7c
Name:
Type: Gene
Species: Mouse
Chromosome: 12
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 14,887,023 bp
  • CTTTT to CTTTTT, chromosome 1 at 130,419,600 bp
  • GGTGTG to GGTGTGTG, chromosome 1 at 171,463,088 bp
  • T to A, chromosome 2 at 27,922,123 bp
  • C to T, chromosome 2 at 86,236,518 bp
  • T to C, chromosome 2 at 103,279,631 bp
  • C to A, chromosome 3 at 61,365,130 bp
  • A to G, chromosome 3 at 83,838,066 bp
  • A to C, chromosome 3 at 129,855,001 bp
  • A to T, chromosome 3 at 130,040,950 bp
  • TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT to TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT, chromosome 4 at 156,218,068 bp
  • A to C, chromosome 5 at 36,614,058 bp
  • T to C, chromosome 5 at 41,831,507 bp
  • A to T, chromosome 5 at 72,764,259 bp
  • A to G, chromosome 5 at 103,867,600 bp
  • G to C, chromosome 5 at 136,697,971 bp
  • A to T, chromosome 5 at 142,211,958 bp
  • T to C, chromosome 6 at 83,103,216 bp
  • T to C, chromosome 6 at 125,060,958 bp
  • A to G, chromosome 6 at 142,275,476 bp
  • T to A, chromosome 7 at 28,368,292 bp
  • A to G, chromosome 7 at 86,466,182 bp
  • T to A, chromosome 7 at 101,992,669 bp
  • T to C, chromosome 8 at 61,329,930 bp
  • A to C, chromosome 8 at 88,664,157 bp
  • A to T, chromosome 8 at 105,363,324 bp
  • A to G, chromosome 8 at 108,950,717 bp
  • G to A, chromosome 9 at 26,756,869 bp
  • T to A, chromosome 9 at 56,890,353 bp
  • C to T, chromosome 9 at 59,678,809 bp
  • T to C, chromosome 9 at 66,779,272 bp
  • T to C, chromosome 9 at 119,954,628 bp
  • A to T, chromosome 11 at 58,580,966 bp
  • A to T, chromosome 12 at 36,208,677 bp
  • GTAGTGTATA to GTA, chromosome 12 at 85,803,148 bp
  • T to A, chromosome 13 at 41,012,650 bp
  • G to T, chromosome 13 at 50,469,723 bp
  • T to C, chromosome 13 at 74,672,818 bp
  • T to C, chromosome 15 at 12,259,640 bp
  • A to T, chromosome 15 at 27,818,969 bp
  • A to G, chromosome 15 at 76,067,155 bp
  • C to A, chromosome 16 at 29,403,801 bp
  • A to G, chromosome 16 at 55,226,932 bp
  • T to C, chromosome 17 at 18,243,724 bp
  • T to A, chromosome 17 at 31,851,312 bp
  • T to C, chromosome 18 at 36,946,921 bp
  • G to C, chromosome 18 at 60,829,051 bp
  • T to A, chromosome 19 at 5,963,827 bp
  • G to T, chromosome 19 at 17,120,116 bp
  • C to T, chromosome 19 at 37,207,811 bp
  • C to T, chromosome 19 at 41,624,520 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8217 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067658-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.