Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8317Btlr/Mmmh
Stock Number:
067721-MU
Citation ID:
RRID:MMRRC_067721-MU
Other Names:
R8317 (G1)
Major Collection:

Strain Information

Adipor1
Name: adiponectin receptor 1
Synonyms: 2810031L11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72674
Homologene: 69199
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Skap2
Name: src family associated phosphoprotein 2
Synonyms: RA70, Saps, mSKAP55R, 2610021A10Rik, SKAP-HOM
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54353
Homologene: 2919
Cilk1
Name: ciliogenesis associated kinase 1
Synonyms: 2210420N10Rik, Ick
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56542
Homologene: 69218
Net1
Name: neuroepithelial cell transforming gene 1
Synonyms: mNET1, Net1 homolog, 9530071N24Rik, 0610025H04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56349
VEGA: 13
Homologene: 4283
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 58,676,548 bp
  • C to T, chromosome 1 at 134,428,167 bp
  • A to G, chromosome 1 at 158,764,960 bp
  • A to G, chromosome 2 at 17,350,757 bp
  • T to C, chromosome 2 at 160,990,321 bp
  • T to C, chromosome 2 at 180,206,991 bp
  • T to C, chromosome 3 at 38,958,510 bp
  • T to G, chromosome 4 at 15,970,893 bp
  • A to T, chromosome 4 at 25,008,223 bp
  • C to A, chromosome 4 at 118,437,126 bp
  • C to A, chromosome 4 at 131,957,650 bp
  • C to T, chromosome 5 at 37,454,975 bp
  • A to C, chromosome 5 at 98,737,600 bp
  • A to T, chromosome 5 at 110,009,056 bp
  • A to G, chromosome 6 at 51,907,885 bp
  • T to C, chromosome 6 at 54,943,440 bp
  • C to A, chromosome 6 at 70,913,292 bp
  • TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,905 bp
  • C to T, chromosome 6 at 124,855,153 bp
  • T to A, chromosome 7 at 76,422,181 bp
  • T to C, chromosome 7 at 83,655,330 bp
  • T to A, chromosome 7 at 85,136,626 bp
  • A to G, chromosome 7 at 92,875,390 bp
  • A to T, chromosome 7 at 126,413,443 bp
  • CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT to CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT, chromosome 7 at 142,273,816 bp
  • A to T, chromosome 8 at 3,922,018 bp
  • A to G, chromosome 8 at 4,354,138 bp
  • G to C, chromosome 8 at 105,827,806 bp
  • C to A, chromosome 9 at 18,484,821 bp
  • G to A, chromosome 9 at 18,658,043 bp
  • T to A, chromosome 9 at 78,153,651 bp
  • A to G, chromosome 9 at 103,217,516 bp
  • G to A, chromosome 10 at 8,729,386 bp
  • A to T, chromosome 10 at 60,311,258 bp
  • G to A, chromosome 10 at 60,436,789 bp
  • T to C, chromosome 10 at 80,495,327 bp
  • G to C, chromosome 10 at 81,144,950 bp
  • T to A, chromosome 10 at 81,280,490 bp
  • T to G, chromosome 10 at 99,759,038 bp
  • C to A, chromosome 11 at 60,200,657 bp
  • A to T, chromosome 11 at 100,703,562 bp
  • T to C, chromosome 13 at 3,907,856 bp
  • G to C, chromosome 13 at 22,772,777 bp
  • G to A, chromosome 13 at 67,783,839 bp
  • C to T, chromosome 13 at 81,575,117 bp
  • T to C, chromosome 13 at 81,678,183 bp
  • T to C, chromosome 13 at 111,758,162 bp
  • A to C, chromosome 14 at 24,191,230 bp
  • A to T, chromosome 14 at 47,263,537 bp
  • A to G, chromosome 14 at 51,195,892 bp
  • A to T, chromosome 15 at 58,205,230 bp
  • A to G, chromosome 15 at 81,980,777 bp
  • T to G, chromosome 16 at 13,541,100 bp
  • T to A, chromosome 16 at 14,208,077 bp
  • T to G, chromosome 16 at 29,614,144 bp
  • C to A, chromosome 16 at 49,120,018 bp
  • C to A, chromosome 16 at 93,862,529 bp
  • A to T, chromosome 17 at 7,800,888 bp
  • A to C, chromosome 17 at 71,749,202 bp
  • A to G, chromosome 19 at 8,771,043 bp
  • G to A, chromosome 19 at 31,084,248 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8317 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067721-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.