Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8317Btlr/Mmmh
Stock Number:
067721-MU
Citation ID:
RRID:MMRRC_067721-MU
Other Names:
R8317 (G1)
Major Collection:

Strain Information

Adipor1
Name: adiponectin receptor 1
Synonyms: 2810031L11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72674
Homologene: 69199
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 1100001C18Rik, A330076K04Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Foxp1
Name: forkhead box P1
Synonyms: 4932443N09Rik, 3110052D19Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 108655
HGNC: HGNC:3823
Homologene: 13092
Skap2
Name: src family associated phosphoprotein 2
Synonyms: RA70, Saps, mSKAP55R, 2610021A10Rik, SKAP-HOM
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54353
Homologene: 2919
Cilk1
Name: ciliogenesis associated kinase 1
Synonyms: 2210420N10Rik, Ick
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56542
Homologene: 69218
Net1
Name: neuroepithelial cell transforming gene 1
Synonyms: mNET1, Net1 homolog, 9530071N24Rik, 0610025H04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56349
VEGA: 13
Homologene: 4283
Morc3
Name: microrchidia 3
Synonyms: 1110051N18Rik, D16Jhu32e, 1110051N18Rik, Zcwcc3
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 338467
Homologene: 32257
Epb41
Name: erythrocyte membrane protein band 4.1
Synonyms: 4.1R, Elp-1, Elp1, D4Ertd442e, Epb4.1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269587
HGNC: HGNC:3377
Homologene: 44324
Opa1
Name: OPA1, mitochondrial dynamin like GTPase
Synonyms: 1200011N24Rik, lilr3, optic atrophy 1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74143
HGNC: HGNC:8140
Homologene: 14618
Parn
Name: poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms: DAN, 1200003I18Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74108
VEGA: 16
HGNC: HGNC:8609
Homologene: 31098
Nbn
Name: nibrin
Synonyms: Nbs1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27354
HGNC: HGNC:7652
Homologene: 1858
Trf
Name: transferrin
Synonyms: Tfn, HP
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22041
Homologene: 68153
Fbxo32
Name: F-box protein 32
Synonyms: 4833442G10Rik, ATROGIN1, MAFbx, atrogin-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67731
VEGA: 15
Homologene: 12182
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Map3k1
Name: mitogen-activated protein kinase kinase kinase 1
Synonyms: MEKK1, Mekk
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26401
HGNC: HGNC:6848
Homologene: 8056
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Srebf1
Name: sterol regulatory element binding transcription factor 1
Synonyms: SREBP-1, ADD-1, SREBP-1c, SREBP-1a, SREBP1, SREBP1c, bHLHd1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20787
Homologene: 3079
Nxf1
Name: nuclear RNA export factor 1
Synonyms: Tip associated protein, TAP, Mex67, Mvb1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 53319
HGNC: HGNC:8071
Homologene: 38176
Cdc20
Name: cell division cycle 20
Synonyms: p55CDC, 2310042N09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107995
HGNC: HGNC:1723
Homologene: 37459
Polr3g
Name: polymerase (RNA) III (DNA directed) polypeptide G
Synonyms: RPC32, 2310047G20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 67486
Homologene: 38184
Chd6
Name: chromodomain helicase DNA binding protein 6
Synonyms: 6330406J24Rik, 5430439G14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71389
Homologene: 32772
Prcp
Name: prolylcarboxypeptidase (angiotensinase C)
Synonyms: 2610104A14Rik, 2510048K03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72461
HGNC: HGNC:9344
Homologene: 55867
Stk32b
Name: serine/threonine kinase 32B
Synonyms: 2510009F08Rik, YANK2, STKG6, Stk32
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 64293
Homologene: 48654
Cd209b
Name: CD209b antigen
Synonyms: SIGNR1, mSIGNR1, 1810030I22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 69165
Homologene: 84858
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, nmf252, bob, nmf112, nmf181, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Cfap299
Name: cilia and flagella associated protein 299
Synonyms: 1700007G11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75784
Homologene: 51893
Myh15
Name: myosin, heavy chain 15
Synonyms: EG667772
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 667772
VEGA: 16
Homologene: 18929
P3h3
Name: prolyl 3-hydroxylase 3
Synonyms: Grcb, Leprel2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14789
Homologene: 8401
Agbl1
Name: ATP/GTP binding protein-like 1
Synonyms: Nna1-l1, EG244071, Ccp4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244071
Homologene: 17552
Gpr63
Name: G protein-coupled receptor 63
Synonyms: PSP24beta
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 81006
Homologene: 12759
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Mbd3l1
Name: methyl-CpG binding domain protein 3-like 1
Synonyms: 1700070G05Rik, Mbd3l, 1700095H13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73503
VEGA: 9
Homologene: 12502
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Cstf2t
Name: cleavage stimulation factor, 3' pre-RNA subunit 2, tau
Synonyms: tCstF-64, 64kDa
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83410
VEGA: 19
Homologene: 80230
Nebl
Name: nebulette
Synonyms: Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74103
Homologene: 128431
Vmn1r208
Name: vomeronasal 1 receptor 208
Synonyms: V1rh9, Vmn1r208-ps
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171252
Homologene: 110880
Nod1
Name: nucleotide-binding oligomerization domain containing 1
Synonyms: F830007N14Rik, Card4, Nlrc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 107607
Homologene: 4440
Dhx58
Name: DExH-box helicase 58
Synonyms: B430001I08Rik, LPG2, D11Lgp2e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 80861
Homologene: 69371
Pappa2
Name: pappalysin 2
Synonyms: placenta-specific 3, pregnancy-associated plasma preproprotein-A2, pregnancy-associated plasma protein-E, PAPP-A2, PLAC3, Pappe
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 23850
Homologene: 10661
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Zfp932
Name: zinc finger protein 932
Synonyms: 2310001H12Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 69504
Homologene: 137770
Wdhd1
Name: WD repeat and HMG-box DNA binding protein 1
Synonyms: AND-1, D630024B06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218973
Homologene: 56019
Tsnaxip1
Name: translin-associated factor X (Tsnax) interacting protein 1
Synonyms: TXI1, 1700016K08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72236
Homologene: 10194
Ang2
Name: angiogenin, ribonuclease A family, member 2
Synonyms: Rnase5b, Angrp
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11731
VEGA: 14
HGNC: HGNC:483
Fndc1
Name: fibronectin type III domain containing 1
Synonyms: 1110027O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68655
Pcare
Name: photoreceptor cilium actin regulator
Synonyms: BC027072
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225004
VEGA: 17
Homologene: 19792
Vmn2r67
Name: vomeronasal 2, receptor 67
Synonyms: EG620672
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620672
Homologene: 115466
Flacc1
Name: flagellum associated containing coiled-coil domains 1
Synonyms: 4933405P16Rik, 4933425F06Rik, Als2cr12
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108812
Homologene: 51399
Zbtb7a
Name: zinc finger and BTB domain containing 7a
Synonyms: Lrf, 9030619K07Rik, 9130006G12Rik, FBI-1, Zbtb7, Pokemon, Leukemia/lymphoma Related Factor
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16969
Homologene: 7820
Tjp3
Name: tight junction protein 3
Synonyms: ZO-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 27375
VEGA: 10
Homologene: 8458
Ccl25
Name: C-C motif chemokine ligand 25
Synonyms: TECK, CKb15, Scya25
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20300
Homologene: 4109
Zfp493
Name: zinc finger protein 493
Synonyms: 2900054J07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72958
Onecut3
Name: one cut domain, family member 3
Synonyms: OC-3, Oc3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 246086
Homologene: 82258
Spmip9
Name: sperm microtubule inner protein 9
Synonyms: 1700011F03Rik, Tex37
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74221
Homologene: 17643
Ndufb11b
Name: NADH:ubiquinone oxidoreductase subunit B11B
Synonyms: 1700029P11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66346
Homologene: 32635
Csl
Name: citrate synthase like
Synonyms: 1700007H16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71832
VEGA: 10
HGNC: HGNC:2422
Homologene: 7131
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 58,676,548 bp
  • C to T, chromosome 1 at 134,428,167 bp
  • A to G, chromosome 1 at 158,764,960 bp
  • A to G, chromosome 2 at 17,350,757 bp
  • T to C, chromosome 2 at 160,990,321 bp
  • T to C, chromosome 2 at 180,206,991 bp
  • T to C, chromosome 3 at 38,958,510 bp
  • T to G, chromosome 4 at 15,970,893 bp
  • A to T, chromosome 4 at 25,008,223 bp
  • C to A, chromosome 4 at 118,437,126 bp
  • C to A, chromosome 4 at 131,957,650 bp
  • C to T, chromosome 5 at 37,454,975 bp
  • A to C, chromosome 5 at 98,737,600 bp
  • A to T, chromosome 5 at 110,009,056 bp
  • A to G, chromosome 6 at 51,907,885 bp
  • T to C, chromosome 6 at 54,943,440 bp
  • C to A, chromosome 6 at 70,913,292 bp
  • TTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGTTGCTGCTGCTGTTGCTGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCTGTTGCTGCTGCTG, chromosome 6 at 99,075,905 bp
  • C to T, chromosome 6 at 124,855,153 bp
  • T to A, chromosome 7 at 76,422,181 bp
  • T to C, chromosome 7 at 83,655,330 bp
  • T to A, chromosome 7 at 85,136,626 bp
  • A to G, chromosome 7 at 92,875,390 bp
  • A to T, chromosome 7 at 126,413,443 bp
  • CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT to CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT, chromosome 7 at 142,273,816 bp
  • A to T, chromosome 8 at 3,922,018 bp
  • A to G, chromosome 8 at 4,354,138 bp
  • G to C, chromosome 8 at 105,827,806 bp
  • C to A, chromosome 9 at 18,484,821 bp
  • G to A, chromosome 9 at 18,658,043 bp
  • T to A, chromosome 9 at 78,153,651 bp
  • A to G, chromosome 9 at 103,217,516 bp
  • G to A, chromosome 10 at 8,729,386 bp
  • A to T, chromosome 10 at 60,311,258 bp
  • G to A, chromosome 10 at 60,436,789 bp
  • T to C, chromosome 10 at 80,495,327 bp
  • G to C, chromosome 10 at 81,144,950 bp
  • T to A, chromosome 10 at 81,280,490 bp
  • T to G, chromosome 10 at 99,759,038 bp
  • C to A, chromosome 11 at 60,200,657 bp
  • A to T, chromosome 11 at 100,703,562 bp
  • T to C, chromosome 13 at 3,907,856 bp
  • G to C, chromosome 13 at 22,772,777 bp
  • G to A, chromosome 13 at 67,783,839 bp
  • C to T, chromosome 13 at 81,575,117 bp
  • T to C, chromosome 13 at 81,678,183 bp
  • T to C, chromosome 13 at 111,758,162 bp
  • A to C, chromosome 14 at 24,191,230 bp
  • A to T, chromosome 14 at 47,263,537 bp
  • A to G, chromosome 14 at 51,195,892 bp
  • A to T, chromosome 15 at 58,205,230 bp
  • A to G, chromosome 15 at 81,980,777 bp
  • T to G, chromosome 16 at 13,541,100 bp
  • T to A, chromosome 16 at 14,208,077 bp
  • T to G, chromosome 16 at 29,614,144 bp
  • C to A, chromosome 16 at 49,120,018 bp
  • C to A, chromosome 16 at 93,862,529 bp
  • A to T, chromosome 17 at 7,800,888 bp
  • A to C, chromosome 17 at 71,749,202 bp
  • A to G, chromosome 19 at 8,771,043 bp
  • G to A, chromosome 19 at 31,084,248 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8317 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067721-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.