Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8407Btlr/Mmmh
Stock Number:
067814-MU
Citation ID:
RRID:MMRRC_067814-MU
Other Names:
R8407 (G1)
Major Collection:

Strain Information

Nfat5
Name: nuclear factor of activated T cells 5
Synonyms: nfatz, TonEBP, B130038B15Rik, OREBP
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54446
HGNC: HGNC:7774
Homologene: 4811
Ptch1
Name: patched 1
Synonyms: Ptc, Patched 1, Ptc1, A230106A15Rik, wig
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 19206
HGNC: HGNC:9585
Homologene: 223
Rps19
Name: ribosomal protein S19
Synonyms: Dsk3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20085
Homologene: 37416
Arhgef12
Name: Rho guanine nucleotide exchange factor 12
Synonyms: LARG, 2310014B11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69632
VEGA: 9
Homologene: 9088
Mapk14
Name: mitogen-activated protein kinase 14
Synonyms: p38-alpha, p38, p38 MAP Kinase, Mxi2, CSBP2, Crk1, Csbp1, p38MAPK, p38a, p38 alpha, p38alpha, p38 MAP kinase alpha, p38 MAPK
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26416
HGNC: HGNC:6876
Homologene: 31777
Acly
Name: ATP citrate lyase
Synonyms: A730098H14Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104112
HGNC: HGNC:115
Homologene: 854
Cnot4
Name: CCR4-NOT transcription complex, subunit 4
Synonyms: Not4h, Not4, Not4hp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 53621
HGNC: HGNC:7880
Homologene: 40870
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 72,601,395 bp
  • A to G, chromosome 1 at 135,364,025 bp
  • C to A, chromosome 1 at 135,364,996 bp
  • A to C, chromosome 2 at 87,868,093 bp
  • T to C, chromosome 2 at 148,823,204 bp
  • T to A, chromosome 2 at 165,514,867 bp
  • T to C, chromosome 4 at 41,394,488 bp
  • T to A, chromosome 4 at 133,247,593 bp
  • T to C, chromosome 4 at 134,757,425 bp
  • C to T, chromosome 4 at 155,268,216 bp
  • A to G, chromosome 5 at 107,570,191 bp
  • G to A, chromosome 5 at 140,613,226 bp
  • A to G, chromosome 6 at 35,056,219 bp
  • A to G, chromosome 6 at 41,675,338 bp
  • C to A, chromosome 7 at 24,889,092 bp
  • G to A, chromosome 7 at 45,920,021 bp
  • T to C, chromosome 7 at 79,723,303 bp
  • C to T, chromosome 8 at 107,367,415 bp
  • C to T, chromosome 9 at 43,026,179 bp
  • C to A, chromosome 9 at 65,274,616 bp
  • A to T, chromosome 9 at 85,721,066 bp
  • C to T, chromosome 9 at 106,155,942 bp
  • T to A, chromosome 9 at 108,438,432 bp
  • A to G, chromosome 9 at 108,829,057 bp
  • T to A, chromosome 9 at 109,326,201 bp
  • T to C, chromosome 10 at 79,268,194 bp
  • T to A, chromosome 10 at 108,240,181 bp
  • A to G, chromosome 10 at 127,295,449 bp
  • T to A, chromosome 10 at 128,482,321 bp
  • G to T, chromosome 10 at 128,511,927 bp
  • T to C, chromosome 11 at 20,240,446 bp
  • C to A, chromosome 11 at 58,175,330 bp
  • T to C, chromosome 11 at 69,459,278 bp
  • T to C, chromosome 11 at 69,778,275 bp
  • T to C, chromosome 11 at 100,494,071 bp
  • C to T, chromosome 11 at 106,568,395 bp
  • A to G, chromosome 11 at 116,252,763 bp
  • G to T, chromosome 13 at 22,036,047 bp
  • T to A, chromosome 13 at 55,322,859 bp
  • T to C, chromosome 13 at 63,514,243 bp
  • A to G, chromosome 13 at 118,715,402 bp
  • T to C, chromosome 14 at 54,963,931 bp
  • A to G, chromosome 14 at 79,213,912 bp
  • T to A, chromosome 14 at 123,317,271 bp
  • C to T, chromosome 15 at 88,914,538 bp
  • A to T, chromosome 16 at 56,927,888 bp
  • AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG to AGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCGCAGGAGCCGAACCCCCAGCCG, chromosome 16 at 91,660,334 bp
  • A to C, chromosome 17 at 12,421,481 bp
  • G to A, chromosome 17 at 28,745,009 bp
  • A to T, chromosome 17 at 32,634,184 bp
  • G to A, chromosome 17 at 34,841,127 bp
  • A to T, chromosome 17 at 47,698,627 bp
  • C to A, chromosome 17 at 52,905,073 bp
  • A to G, chromosome 18 at 46,560,523 bp
  • C to T, chromosome 19 at 9,015,673 bp
  • G to A, chromosome 19 at 47,110,316 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8407 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067814-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.