Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8509Btlr/Mmmh
Stock Number:
067944-MU
Citation ID:
RRID:MMRRC_067944-MU
Other Names:
R8509 (G1)
Major Collection:

Strain Information

Angpt2
Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11601
HGNC: HGNC:485
Homologene: 22401
Mcoln3
Name: mucolipin 3
Synonyms: varitint-waddler, Va, 6720490O21Rik, TRPML3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 171166
Homologene: 10118
Fancd2
Name: Fanconi anemia, complementation group D2
Synonyms: 2410150O07Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 211651
HGNC: HGNC:3585
Homologene: 13212
Ncoa7
Name: nuclear receptor coactivator 7
Synonyms: 9030406N13Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 211329
VEGA: 10
Homologene: 65245
Lrba
Name: LPS-responsive beige-like anchor
Synonyms: Lba, D3Ertd775e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80877
HGNC: HGNC:1742
Homologene: 36205
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Smg6
Name: SMG6 nonsense mediated mRNA decay factor
Synonyms: Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103677
Homologene: 23024
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Hey1
Name: hairy/enhancer-of-split related with YRPW motif 1
Synonyms: hesr-1, HRT1, Herp2, Hesr1, bHLHb31, CHF2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 15213
HGNC: HGNC:4880
Homologene: 7756
1110004F10Rik
Name: RIKEN cDNA 1110004F10 gene
Synonyms: sid2057
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56372
Homologene: 8606
Trpm4
Name: transient receptor potential cation channel, subfamily M, member 4
Synonyms: TRPM4B, 1110030C19Rik, LTRPC4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 68667
Homologene: 23033
Sbf1
Name: SET binding factor 1
Synonyms: Mtmr5, B230113C15Rik, 2610510A08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77980
Homologene: 84710
Inpp5b
Name: inositol polyphosphate-5-phosphatase B
Synonyms: 75kDa
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 16330
HGNC: HGNC:6077
Homologene: 69021
Taf4b
Name: TATA-box binding protein associated factor 4b
Synonyms: Taf2c2, TAFII105, 105kDa, 2610524B04Rik, 4932409F03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72504
VEGA: 18
Homologene: 28266
Brip1
Name: BRCA1 interacting protein C-terminal helicase 1
Synonyms: BACH1, 8030460J03Rik, 3110009N10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237911
Homologene: 32766
Cep95
Name: centrosomal protein 95
Synonyms: F630025I20Rik, 4732496G21Rik, Ccdc45
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 320162
Homologene: 16297
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Rtp1
Name: receptor transporter protein 1
Synonyms: LOC239766, LOC385871
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239766
VEGA: 16
Homologene: 17806
Srgap3
Name: SLIT-ROBO Rho GTPase activating protein 3
Synonyms: Arhgap14, D130026O08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 259302
Homologene: 56686
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
Gm10800
Name: predicted gene 10800
Type: Gene
Species: Mouse
Chromosome: 2
Cabcoco1
Name: ciliary associated calcium binding coiled-coil 1
Synonyms: 1700040L02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73287
Homologene: 12495
Ripk2
Name: receptor (TNFRSF)-interacting serine-threonine kinase 2
Synonyms: CCK, CARDIAK, RIP2, RICK, CARD3, D4Bwg0615e, 2210420D18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 192656
Homologene: 37856
Ccnb1ip1
Name: cyclin B1 interacting protein 1
Synonyms: LOC239083, mei4, Hei10
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 239083
VEGA: 14
Homologene: 18819
Spata31h1
Name: SPATA31 subfamily H member 1
Synonyms: 4932415D10Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 102635990
VEGA: 10
Homologene: 82476
Trim46
Name: tripartite motif-containing 46
Synonyms: TRIFIC
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 360213
Homologene: 11815
Gmcl1
Name: germ cell-less, spermatogenesis associated 1
Synonyms: mglc-1, 2810049L19Rik, Gcl, Btbd13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23885
Homologene: 8021
Asrgl1
Name: asparaginase like 1
Synonyms: ALP1, 2410004D18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66514
Homologene: 11825
Sgf29
Name: SAGA complex associated factor 29
Synonyms: 1700023O11Rik, Ccdc101
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 75565
Homologene: 12607
Lrrcc1
Name: leucine rich repeat and coiled-coil domain containing 1
Synonyms: 4932441F23Rik, 1200008A14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71710
Homologene: 12559
Npffr2
Name: neuropeptide FF receptor 2
Synonyms: NPFF2, Gpr74
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 104443
HGNC: HGNC:4525
Homologene: 56982
Plscr4
Name: phospholipid scramblase 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235527
Homologene: 23217
Slc22a8
Name: solute carrier family 22 (organic anion transporter), member 8
Synonyms: Roct, OAT3, mOat3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19879
VEGA: 19
Homologene: 20901
Ano3
Name: anoctamin 3
Synonyms: B230324K02Rik, Tmem16c
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228432
Homologene: 57147
Hyal6
Name: hyaluronoglucosaminidase 6
Synonyms: 4932701A20Rik, Hyal-ps1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74409
HGNC: HGNC:5324
Homologene: 78028
Rnf19b
Name: ring finger protein 19B
Synonyms: 4930534K13Rik, 4930555L03Rik, Ibrdc3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75234
Homologene: 34999
Cyp11b1
Name: cytochrome P450, family 11, subfamily b, polypeptide 1
Synonyms: Cyp11b-1, Cyp11b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110115
Homologene: 106948
Trim12a
Name: tripartite motif-containing 12A
Synonyms: 2310043C01Rik, Trim12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76681
Ndufb4
Name: NADH:ubiquinone oxidoreductase subunit B4
Synonyms: 0610006N12Rik, 1300010H20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68194
HGNC: HGNC:7699
Homologene: 3342
Hbb-bs
Name: hemoglobin, beta adult s chain
Synonyms: beta s
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100503605
Homologene: 68066
Or5d20
Name: olfactory receptor family 5 subfamily D member 20
Synonyms: GA_x6K02T2Q125-49593880-49592930, MOR174-7, Or5d20-ps1, Olfr1165-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258642
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 66,641,629 bp
  • T to A, chromosome 1 at 150,573,551 bp
  • C to T, chromosome 1 at 181,814,655 bp
  • T to C, chromosome 2 at 88,101,522 bp
  • AAGAAAACTGAAAATCAT to A, chromosome 2 at 98,667,034 bp
  • T to C, chromosome 2 at 110,665,835 bp
  • G to C, chromosome 3 at 8,664,776 bp
  • A to G, chromosome 3 at 14,536,507 bp
  • G to T, chromosome 3 at 38,981,903 bp
  • A to G, chromosome 3 at 86,348,176 bp
  • A to G, chromosome 3 at 89,245,713 bp
  • A to G, chromosome 3 at 146,124,892 bp
  • T to C, chromosome 4 at 16,124,436 bp
  • T to A, chromosome 4 at 124,743,905 bp
  • T to A, chromosome 4 at 129,073,576 bp
  • T to C, chromosome 5 at 89,583,329 bp
  • A to T, chromosome 6 at 24,734,606 bp
  • A to C, chromosome 6 at 86,722,607 bp
  • G to A, chromosome 6 at 112,731,336 bp
  • A to G, chromosome 6 at 113,572,570 bp
  • A to G, chromosome 7 at 45,322,361 bp
  • T to A, chromosome 7 at 81,495,368 bp
  • T to A, chromosome 7 at 103,826,712 bp
  • T to C, chromosome 7 at 104,306,027 bp
  • T to C, chromosome 7 at 116,104,434 bp
  • T to A, chromosome 7 at 126,671,662 bp
  • CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to CACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,817 bp
  • G to A, chromosome 8 at 18,741,119 bp
  • C to A, chromosome 9 at 54,428,057 bp
  • C to T, chromosome 9 at 92,490,790 bp
  • T to C, chromosome 10 at 30,696,052 bp
  • T to C, chromosome 10 at 68,431,289 bp
  • A to G, chromosome 10 at 82,291,116 bp
  • T to C, chromosome 11 at 75,041,876 bp
  • A to T, chromosome 11 at 86,197,948 bp
  • A to G, chromosome 11 at 106,805,050 bp
  • A to G, chromosome 13 at 11,577,778 bp
  • T to C, chromosome 14 at 50,792,257 bp
  • A to G, chromosome 15 at 74,839,353 bp
  • A to T, chromosome 15 at 89,293,457 bp
  • A to T, chromosome 16 at 17,354,144 bp
  • T to C, chromosome 16 at 23,429,314 bp
  • A to G, chromosome 16 at 37,649,144 bp
  • A to G, chromosome 18 at 14,898,055 bp
  • T to C, chromosome 19 at 8,607,975 bp
  • T to C, chromosome 19 at 9,114,226 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8509 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
067944-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.