Register New MMRRC Account
Reset Password
Register for New Mouse Models
Click Here for Additional Contact Information
Availability & Fees Order this Strain
B6.Cg-Gt(ROSA)26Sorem2(CAG-tdTomato)Jahe; Ai9-Cas12a; NCFP
CRISPR/Cas9 genome-editing was used to modify embryos from B6.Cg-Gt(ROSA)26Sortm9(CAG-tdTomato)Hze/J (RRID:IMSR_JAX:007909 - "Ai9"). Guide target sequences for Acidaminococcus sp., and Lachnospiraceae sp. Cas12a found on the 5' end of the loxP-flanked stop cassette [5'(PAM TTTG) GCAAAGAATTGATTTGATACCGC] are duplicated onto the 3' end of the stop cassette. The modification of Ai9 leads to the partial deletion of the loxP site on the 3' end of the stop cassette.
Using CRISPR/Cas9 genome editing in mouse embryos, the existing Rosa-CAG-LSL-tdTomato-WPRE conditional allele Gt(ROSA)26Sortm9(CAG-tdTomato)Hze (commonly referred to as Ai9; RRID:IMSR_JAX:007909) was modified to duplicate the guide target sequences for Acidaminococcus sp. and Lachnospiraceae sp. cas12a found on the 5' end of the loxP-flanked stop cassette onto the 3' end of the stop cassette. With this modification, a single guide RNA for Acidaminococcus sp. or Lachnospiraceae sp. cas12a can be used to mediate deletion of the stop cassette by non-homologous end-joining to activate tdTomato expression. The donating investigator indicates that it is believed that the remaining sequence is not sufficient for cre-mediated recombination with the 5' loxP site.
Mice homozygous for Ai9-Cas12a or NCFP are viable and fertile. Tint from the fluorochromes may be visually apparent on furless skin.
CRISPR/Cas9 genome-editing was used (as specified above). Founder mice with the Ai9-Cas12a allele were identified by PCR and sequencing. Founders were bred to C57BL/6J mice for germline transmission further backcrossed to C57BL/6J for an additional 3 generations. The strain was then bred to homozygosity. Upon arrival, mice were bred to C57BL/6J for at least 1 generation to establish the colony.
Cryo-recovered strains distributed by the MMRRC at JAX are shipped to the customer from the Pathogen & Opportunistic-Free Animal Room G200 - see https://www.jax.org/jax-mice-and-services/customer-support/customer-service/animal-health/health-status-reports.
N5 (C57BL/6J), F? (to homozygosity)
Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.
Cryopreserved material may be available upon request, please inquire to csmmrrc@jax.org for more information.
Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.
Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.
1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.
2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.
3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.
4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.