Strain Name:
C57BL/6J-MtgxR8543Btlr/Mmmh
Stock Number:
068508-MU
Citation ID:
RRID:MMRRC_068508-MU
Other Names:
R8543 (G1)
Major Collection:

Strain Information

Blm
Name: Bloom syndrome, RecQ like helicase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12144
HGNC: HGNC:1058
Homologene: 47902
Ltbp4
Name: latent transforming growth factor beta binding protein 4
Synonyms: 2310046A13Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108075
HGNC: HGNC:6717
Homologene: 2645
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: Vprbp, B930007L02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Vcl
Name: vinculin
Synonyms: metavinculin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 22330
VEGA: 14
Homologene: 7594
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: Bruce, D630005A10Rik, A430040A19Rik, apollon, A430032G04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Sorbs1
Name: sorbin and SH3 domain containing 1
Synonyms: CAP, 2310065E01Rik, 9530001P15Rik, Sh3d5, c-Cbl-associated protein, Ponsin
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20411
VEGA: 19
Homologene: 83252
Cep350
Name: centrosomal protein 350
Synonyms: 6430546F08Rik, 4933409L06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74081
Homologene: 8879
Ank3
Name: ankyrin 3, epithelial
Synonyms: AnkG, Ank-3, Ankyrin-3, Ankyrin-G, 2900054D09Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11735
HGNC: HGNC:494
Homologene: 56908
Iars2
Name: isoleucine-tRNA synthetase 2, mitochondrial
Synonyms: 2010002H18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381314
Homologene: 7118
Lef1
Name: lymphoid enhancer binding factor 1
Synonyms: Lef-1, lymphoid enhancer factor 1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 16842
HGNC: HGNC:6551
Homologene: 7813
Ankrd13c
Name: ankyrin repeat domain 13c
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433667
Homologene: 41804
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Gprc5c
Name: G protein-coupled receptor, family C, group 5, member C
Synonyms: 3200002M13Rik, 1110028I06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70355
Homologene: 11099
Dnajb11
Name: DnaJ heat shock protein family (Hsp40) member B11
Synonyms: Dj9, 1810031F23Rik, ERdj3, ABBP-2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67838
Homologene: 9464
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 6530407C02Rik, 4732496O19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99470
Homologene: 26431
Trmt44
Name: tRNA methyltransferase 44
Synonyms: 2310079F23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78890
Homologene: 12708
Zfp668
Name: zinc finger protein 668
Synonyms: E130018B19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244219
Homologene: 11667
Arhgap30
Name: Rho GTPase activating protein 30
Synonyms: 6030405P05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226652
Homologene: 18766
Trim17
Name: tripartite motif-containing 17
Synonyms: terf, Rnf16
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56631
Homologene: 9387
Coro1a
Name: coronin, actin binding protein 1A
Synonyms: Clabp, coronin 1, p57, Lmb3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12721
HGNC: HGNC:2252
Homologene: 6545
Fat4
Name: FAT atypical cadherin 4
Synonyms: 6030410K14Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329628
Homologene: 14377
D130043K22Rik
Name: RIKEN cDNA D130043K22 gene
Synonyms: Kiaa0319
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210108
Homologene: 8878
Zfp282
Name: zinc finger protein 282
Synonyms: HUB1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101095
Homologene: 2647
Nqo2
Name: N-ribosyldihydronicotinamide quinone reductase 2
Synonyms: Ox2, NRH: quinone oxidoreductase, Ox-2, Nmor2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18105
VEGA: 13
HGNC: HGNC:7856
Homologene: 696
Slc3a1
Name: solute carrier family 3, member 1
Synonyms: D2H, NTAA
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20532
VEGA: 17
Homologene: 37289
Arhgef11
Name: Rho guanine nucleotide exchange factor 11
Synonyms: PDZ-RhoGEF, Prg
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 213498
Homologene: 11409
Izumo1
Name: izumo sperm-egg fusion 1
Synonyms: 1700058F15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73456
Homologene: 77701
Zfp747
Name: zinc finger protein 747
Synonyms: 6430604K15Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269997
Homologene: 118005
Kcnj6
Name: potassium inwardly-rectifying channel, subfamily J, member 6
Synonyms: Kir3.2, GIRK2, KCNJ7
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16522
VEGA: 16
HGNC: HGNC:6267
Homologene: 1688
Serpinb9c
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9c
Synonyms: Spi11, 3830421J05Rik, NK9, ovalbumin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20707
HGNC: HGNC:8955
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Tmem132d
Name: transmembrane protein 132D
Synonyms: C630028F04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243274
Homologene: 71684
Tmco4
Name: transmembrane and coiled-coil domains 4
Synonyms: 4632413C14Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 77056
Homologene: 57112
Notch4
Name: notch 4
Synonyms: Int3, Int-3, N4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18132
HGNC: HGNC:7884
Homologene: 3351
Ampd1
Name: adenosine monophosphate deaminase 1
Synonyms: Ampd-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229665
HGNC: HGNC:468
Homologene: 20
Rin1
Name: Ras and Rab interactor 1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225870
VEGA: 19
Homologene: 3170
Adgrf1
Name: adhesion G protein-coupled receptor F1
Synonyms: Gpr110, 5031409J19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77596
Homologene: 124643
Vmn2r68
Name: vomeronasal 2, receptor 68
Synonyms: EG620697, Vmn2r68-ps
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620697
Homologene: 115466
Krtap5-21
Name: keratin associated protein 5-21
Synonyms: Gm7579
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105243090
Car15
Name: carbonic anhydrase 15
Synonyms: Cals2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 80733
Homologene: 113791
Repin1
Name: replication initiator 1
Synonyms: Zfp464, AP4, E430037F08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 58887
Homologene: 22810
Gpr182
Name: G protein-coupled receptor 182
Synonyms: Admr, Gpcr17, Gpcr22, AM-R, NOW, G10-D
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11536
Homologene: 5255
Cdk14
Name: cyclin dependent kinase 14
Synonyms: Pftk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18647
HGNC: HGNC:8883
Homologene: 7888
Ptpn18
Name: protein tyrosine phosphatase, non-receptor type 18
Synonyms: Ptpk1, PTP-HSCF, PTP-K1, FLP1, HSCF
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19253
HGNC: HGNC:9649
Homologene: 74971
Ankrd63
Name: ankyrin repeat domain 63
Synonyms: LOC383787, Gm1337
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 383787
Homologene: 19774
Mettl17
Name: methyltransferase like 17
Synonyms: D14Ertd209e, Mett11d1, 2310032K15Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52535
Homologene: 11226
Ighg2b
Name: immunoglobulin heavy constant gamma 2B
Synonyms: IgG2b, gamma2b
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16016
Gm49368
Name: predicted gene, 49368
Type: Gene
Species: Mouse
Chromosome: 7
Eppk1
Name: epiplakin 1
Synonyms: EPIPL1, EPPK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223650
VEGA: 15
Homologene: 20006
Or8k31-ps1
Name: olfactory receptor family 8 subfamily K member 31, pseudogene 1
Synonyms: Olfr1077-ps1, GA_x6K02T2Q125-48011447-48010506, MOR189-4P
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 625853
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,472,148 bp
  • A to G, chromosome 1 at 155,862,376 bp
  • T to C, chromosome 1 at 171,404,962 bp
  • CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC to CCCTCCTCTCCCTGGAATGGGAATACCTCCCCCACCTCCTCTCCCTGGAATGGGAATATCTCCCCTACCTCCTCTCCCTGGAATGGGAATACCTCC, chromosome 1 at 174,609,203 bp
  • T to C, chromosome 1 at 185,287,144 bp
  • A to T, chromosome 2 at 86,526,042 bp
  • A to G, chromosome 2 at 118,703,123 bp
  • G to A, chromosome 2 at 177,945,659 bp
  • A to C, chromosome 3 at 38,977,494 bp
  • A to T, chromosome 3 at 87,681,874 bp
  • T to A, chromosome 3 at 103,079,170 bp
  • A to T, chromosome 3 at 104,219,668 bp
  • T to A, chromosome 3 at 131,115,489 bp
  • A to G, chromosome 3 at 158,004,075 bp
  • G to T, chromosome 4 at 139,053,940 bp
  • G to T, chromosome 4 at 145,016,783 bp
  • A to T, chromosome 5 at 5,380,079 bp
  • T to C, chromosome 5 at 35,575,030 bp
  • T to C, chromosome 5 at 128,268,735 bp
  • A to G, chromosome 6 at 47,904,627 bp
  • G to T, chromosome 6 at 48,597,345 bp
  • T to C, chromosome 7 at 27,325,241 bp
  • T to A, chromosome 7 at 45,626,254 bp
  • A to G, chromosome 7 at 80,494,216 bp
  • C to T, chromosome 7 at 85,234,440 bp
  • C to A, chromosome 7 at 126,702,016 bp
  • A to G, chromosome 7 at 127,374,483 bp
  • A to G, chromosome 7 at 127,867,220 bp
  • T to C, chromosome 7 at 128,080,261 bp
  • GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG to GGCTGTGGCTCCTGTGGGGGCTGCAAGGGAAGCTGTGGCTCCTGTGGGGGATGCAAGGGAGGCTGTGGCTCCTGTGGGGG, chromosome 7 at 142,212,045 bp
  • T to G, chromosome 9 at 106,858,078 bp
  • A to G, chromosome 10 at 70,002,436 bp
  • T to C, chromosome 10 at 127,750,992 bp
  • T to A, chromosome 11 at 58,971,455 bp
  • T to A, chromosome 11 at 114,864,268 bp
  • C to A, chromosome 12 at 113,306,932 bp
  • T to A, chromosome 13 at 24,889,869 bp
  • T to A, chromosome 13 at 33,156,434 bp
  • A to T, chromosome 13 at 33,985,314 bp
  • G to T, chromosome 14 at 20,995,059 bp
  • G to A, chromosome 14 at 51,888,800 bp
  • C to T, chromosome 15 at 76,110,119 bp
  • T to C, chromosome 16 at 17,836,849 bp
  • A to T, chromosome 16 at 22,862,585 bp
  • A to T, chromosome 16 at 94,762,391 bp
  • C to T, chromosome 17 at 18,243,722 bp
  • A to G, chromosome 17 at 34,568,420 bp
  • T to A, chromosome 17 at 43,313,206 bp
  • T to C, chromosome 17 at 74,565,865 bp
  • C to A, chromosome 17 at 85,028,497 bp
  • A to G, chromosome 19 at 5,052,072 bp
  • G to C, chromosome 19 at 40,376,800 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8543 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068508-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.