Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8560Btlr/Mmmh
Stock Number:
068523-MU
Citation ID:
RRID:MMRRC_068523-MU
Other Names:
R8560 (G1)
Major Collection:

Strain Information

Sphk2
Name: sphingosine kinase 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56632
Homologene: 32456
Pi4k2a
Name: phosphatidylinositol 4-kinase type 2 alpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 84095
VEGA: 19
Homologene: 101681
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Dock6
Name: dedicator of cytokinesis 6
Synonyms: 2410095B20Rik, 4931431C02Rik, C330023D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Foxo3
Name: forkhead box O3
Synonyms: FKHRL1, Fkhr2, 2010203A17Rik, 1110048B16Rik, Foxo3a
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56484
HGNC: HGNC:3821
Homologene: 31039
Dab2ip
Name: disabled 2 interacting protein
Synonyms: 2310011D08Rik, AIP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69601
Homologene: 13058
Coro1c
Name: coronin, actin binding protein 1C
Synonyms: coronin 3, CRN2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 23790
HGNC: HGNC:2254
Homologene: 56537
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Prpf8
Name: pre-mRNA processing factor 8
Synonyms: DBF3/PRP8, Prp8, D11Bwg0410e, Sfprp8l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192159
Homologene: 4706
Slc33a1
Name: solute carrier family 33 (acetyl-CoA transporter), member 1
Synonyms: Acatn, D630022N01Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11416
HGNC: HGNC:95
Homologene: 3476
Mc4r
Name: melanocortin 4 receptor
Synonyms: Fatboy, Pkcp
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 17202
VEGA: 18
HGNC: HGNC:6932
Homologene: 4320
Stx7
Name: syntaxin 7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 53331
VEGA: 10
Homologene: 37823
Lrpprc
Name: leucine-rich PPR-motif containing
Synonyms: Lrp130, 3110001K13Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72416
Homologene: 32695
Gcfc2
Name: GC-rich sequence DNA binding factor 2
Synonyms: AW146020
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330361
HGNC: HGNC:1317
Homologene: 2411
Ahi1
Name: Abelson helper integration site 1
Synonyms: Ahi-1, 1700015F03Rik, D10Bwg0629e, Jouberin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 52906
VEGA: 10
Homologene: 9762
Kcnh5
Name: potassium voltage-gated channel, subfamily H (eag-related), member 5
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238271
VEGA: 12
HGNC: HGNC:6254
Homologene: 15858
Aak1
Name: AP2 associated kinase 1
Synonyms: 5530400K14Rik, D6Ertd245e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 269774
Homologene: 128746
Rnf41
Name: ring finger protein 41
Synonyms: 4930511A05Rik, FLRF, 4933415P08Rik, 2210404G21Rik, D10Ertd722e, Nrdp1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67588
VEGA: 10
Homologene: 4226
Trmt44
Name: tRNA methyltransferase 44
Synonyms: 2310079F23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78890
Homologene: 12708
Zfp236
Name: zinc finger protein 236
Synonyms: LOC240456
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 329002
Homologene: 7198
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, ALS2CR17, A530083I02Rik, 2310076G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Esyt3
Name: extended synaptotagmin-like protein 3
Synonyms: D9Ertd280e, Fam62c
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 272636
Homologene: 18626
Hydin
Name: HYDIN, axonemal central pair apparatus protein
Synonyms: hy-3, hy3, 1700034M11Rik, 4930545D19Rik, hyrh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244653
Homologene: 52118
Med12l
Name: mediator complex subunit 12-like
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 329650
Homologene: 43143
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Depdc1a
Name: DEP domain containing 1a
Synonyms: 5830484J08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76131
Homologene: 9834
Chsy3
Name: chondroitin sulfate synthase 3
Synonyms: 4833446K15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 78923
VEGA: 18
Homologene: 28624
Mx1
Name: MX dynamin-like GTPase 1
Synonyms: myxovirus (influenza) resistance 1 polypeptide, Mx-1, Mx
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17857
Igkv6-29
Name: immunoglobulin kappa chain variable 6-29
Synonyms: Gm16692
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 620191
HGNC: HGNC:5834
Slc4a1
Name: solute carrier family 4 (anion exchanger), member 1
Synonyms: erythrocyte membrane protein band 3, band 3, Empb3, Ae1, CD233, l11Jus51
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20533
Homologene: 133556
Plb1
Name: phospholipase B1
Synonyms: 4632413E21Rik, 4930433E17Rik, 4930539A06Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 665270
Homologene: 82108
Gucy1b1
Name: guanylate cyclase 1, soluble, beta 1
Synonyms: beta 1 sGC, Gucy1b3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54195
HGNC: HGNC:4687
Homologene: 664
Myh7b
Name: myosin, heavy chain 7B, cardiac muscle, beta
Synonyms: Myh14
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 668940
Homologene: 66117
Il17ra
Name: interleukin 17 receptor A
Synonyms: VDw217, Il17r
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16172
HGNC: HGNC:5985
Homologene: 7378
Dennd5a
Name: DENN domain containing 5A
Synonyms: ORF37, 1500012B19Rik, Rab6ip1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19347
Homologene: 14584
Tmc5
Name: transmembrane channel-like gene family 5
Synonyms: 4932443L08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74424
Homologene: 11713
Slc16a5
Name: solute carrier family 16 (monocarboxylic acid transporters), member 5
Synonyms: MCT5, A130015N09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217316
Homologene: 20985
Krt13
Name: keratin 13
Synonyms: Krt-1.13, K13, Krt1-13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16663
HGNC: HGNC:6415
Homologene: 40740
BB014433
Name: expressed sequence BB014433
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 434285
Pcdhb17
Name: protocadherin beta 17
Synonyms: Pcdhb16, PcdhbQ
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93888
Homologene: 81881
Prkag2
Name: protein kinase, AMP-activated, gamma 2 non-catalytic subunit
Synonyms: 2410051C13Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108099
HGNC: HGNC:9386
Homologene: 136125
Fastkd5
Name: FAST kinase domains 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 380601
Homologene: 36400
Or4q3
Name: olfactory receptor family 4 subfamily Q member 3
Synonyms: GA_x6K02T2PMLR-6042130-6041183, MOR243-1, Olfr735
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 257909
Homologene: 71977
Or5b109
Name: olfactory receptor family 5 subfamily B member 109
Synonyms: GA_x6K02T2RE5P-3560863-3561795, MOR202-29P, Olfr1463
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258120
HGNC: HGNC:8324
Homologene: 133886
Prlhr
Name: prolactin releasing hormone receptor
Synonyms: LOC226278, PrRPR, GR3, Gpr10
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226278
VEGA: 19
HGNC: HGNC:4464
Homologene: 3134
Cybc1
Name: cytochrome b 245 chaperone 1
Synonyms: BC017643
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217370
Homologene: 51645
Or14j4
Name: olfactory receptor family 14 subfamily J member 4
Synonyms: MOR218-11P, GA_x6K02T2PSCP-2070203-2069271, Olfr115
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 257908
Homologene: 115497
Wdr81
Name: WD repeat domain 81
Synonyms: shakey 5, MGC32441, nur5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192652
Homologene: 13983
Klra4
Name: killer cell lectin-like receptor, subfamily A, member 4
Synonyms: Chok, Ly49d, ly49r129
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16635
Homologene: 110821
Nsun5
Name: NOL1/NOP2/Sun domain family, member 5
Synonyms: Nol1r, 9830109N13Rik, Wbscr20a
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100609
Homologene: 6828
Rnf183
Name: ring finger protein 183
Synonyms: 5830442J12Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76072
Homologene: 44917
Zfp51
Name: zinc finger protein 51
Synonyms: zfec12, Zfp-51
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22709
VEGA: 17
Homologene: 134003
Ccdc87
Name: coiled-coil domain containing 87
Synonyms: 4931419P11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 399599
VEGA: 19
Homologene: 49531
Shd
Name: src homology 2 domain-containing transforming protein D
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20420
VEGA: 17
Homologene: 7537
Mal2
Name: mal, T cell differentiation protein 2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105853
VEGA: 15
Homologene: 14167
Cisd3
Name: CDGSH iron sulfur domain 3
Synonyms: Mel13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217149
Homologene: 35399
Trappc5
Name: trafficking protein particle complex 5
Synonyms: TRS31, 4021401A16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66682
Homologene: 5754
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,268,889 bp
  • T to A, chromosome 1 at 60,235,157 bp
  • T to C, chromosome 2 at 35,713,132 bp
  • T to C, chromosome 2 at 76,741,271 bp
  • T to A, chromosome 2 at 130,615,945 bp
  • A to G, chromosome 2 at 155,623,204 bp
  • C to A, chromosome 2 at 177,193,652 bp
  • A to G, chromosome 3 at 59,037,605 bp
  • A to T, chromosome 3 at 63,943,352 bp
  • G to T, chromosome 3 at 82,035,378 bp
  • A to G, chromosome 3 at 159,514,275 bp
  • T to A, chromosome 4 at 32,743,830 bp
  • T to A, chromosome 4 at 62,428,498 bp
  • C to A, chromosome 4 at 88,683,265 bp
  • TTTTTTTTTTTTA to T, chromosome 5 at 24,866,065 bp
  • T to C, chromosome 5 at 32,302,679 bp
  • T to C, chromosome 5 at 35,557,951 bp
  • A to T, chromosome 5 at 113,846,188 bp
  • A to G, chromosome 5 at 135,375,889 bp
  • T to A, chromosome 6 at 38,149,714 bp
  • T to C, chromosome 6 at 70,138,667 bp
  • T to C, chromosome 6 at 81,923,882 bp
  • T to C, chromosome 6 at 86,981,392 bp
  • C to A, chromosome 6 at 120,482,265 bp
  • T to C, chromosome 6 at 124,317,401 bp
  • C to A, chromosome 6 at 130,065,272 bp
  • A to T, chromosome 7 at 45,712,090 bp
  • A to G, chromosome 7 at 109,934,691 bp
  • A to T, chromosome 7 at 118,669,291 bp
  • T to A, chromosome 8 at 3,679,303 bp
  • GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,042,160 bp
  • A to G, chromosome 8 at 110,538,474 bp
  • T to C, chromosome 9 at 21,802,836 bp
  • T to C, chromosome 9 at 99,320,322 bp
  • T to C, chromosome 10 at 20,959,915 bp
  • T to C, chromosome 10 at 24,181,556 bp
  • G to A, chromosome 10 at 42,275,282 bp
  • T to A, chromosome 10 at 128,438,353 bp
  • C to T, chromosome 11 at 75,445,434 bp
  • T to A, chromosome 11 at 75,491,774 bp
  • G to T, chromosome 11 at 97,685,863 bp
  • T to C, chromosome 11 at 100,118,850 bp
  • A to C, chromosome 11 at 102,353,257 bp
  • A to G, chromosome 11 at 115,469,719 bp
  • G to T, chromosome 11 at 121,224,215 bp
  • G to T, chromosome 12 at 74,976,605 bp
  • T to C, chromosome 13 at 92,755,100 bp
  • T to A, chromosome 14 at 50,346,337 bp
  • T to C, chromosome 14 at 54,975,948 bp
  • T to C, chromosome 15 at 54,598,430 bp
  • T to G, chromosome 16 at 97,452,787 bp
  • T to A, chromosome 17 at 21,465,373 bp
  • C to T, chromosome 17 at 37,610,058 bp
  • T to C, chromosome 17 at 55,971,616 bp
  • T to A, chromosome 17 at 84,740,067 bp
  • C to T, chromosome 18 at 37,486,153 bp
  • T to C, chromosome 18 at 59,410,058 bp
  • T to C, chromosome 18 at 66,859,095 bp
  • G to A, chromosome 18 at 82,646,215 bp
  • C to T, chromosome 19 at 4,841,873 bp
  • T to C, chromosome 19 at 13,234,292 bp
  • C to T, chromosome 19 at 42,100,712 bp
  • A to G, chromosome 19 at 60,468,197 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8560 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068523-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.