Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8560Btlr/Mmmh
Stock Number:
068523-MU
Citation ID:
RRID:MMRRC_068523-MU
Other Names:
R8560 (G1)
Major Collection:

Strain Information

Sphk2
Name: sphingosine kinase 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56632
Homologene: 32456
Pi4k2a
Name: phosphatidylinositol 4-kinase type 2 alpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 84095
VEGA: 19
Homologene: 101681
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
D630045J12Rik
Name: RIKEN cDNA D630045J12 gene
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330286
Homologene: 19782
Thbs4
Name: thrombospondin 4
Synonyms: TSP-4, TSP4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 21828
Homologene: 20691
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Dock6
Name: dedicator of cytokinesis 6
Synonyms: 2410095B20Rik, 4931431C02Rik, C330023D02Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319899
VEGA: 9
Homologene: 83291
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 34,268,889 bp
  • T to A, chromosome 1 at 60,235,157 bp
  • T to C, chromosome 2 at 35,713,132 bp
  • T to C, chromosome 2 at 76,741,271 bp
  • T to A, chromosome 2 at 130,615,945 bp
  • A to G, chromosome 2 at 155,623,204 bp
  • C to A, chromosome 2 at 177,193,652 bp
  • A to G, chromosome 3 at 59,037,605 bp
  • A to T, chromosome 3 at 63,943,352 bp
  • G to T, chromosome 3 at 82,035,378 bp
  • A to G, chromosome 3 at 159,514,275 bp
  • T to A, chromosome 4 at 32,743,830 bp
  • T to A, chromosome 4 at 62,428,498 bp
  • C to A, chromosome 4 at 88,683,265 bp
  • TTTTTTTTTTTTA to T, chromosome 5 at 24,866,065 bp
  • T to C, chromosome 5 at 32,302,679 bp
  • T to C, chromosome 5 at 35,557,951 bp
  • A to T, chromosome 5 at 113,846,188 bp
  • A to G, chromosome 5 at 135,375,889 bp
  • T to A, chromosome 6 at 38,149,714 bp
  • T to C, chromosome 6 at 70,138,667 bp
  • T to C, chromosome 6 at 81,923,882 bp
  • T to C, chromosome 6 at 86,981,392 bp
  • C to A, chromosome 6 at 120,482,265 bp
  • T to C, chromosome 6 at 124,317,401 bp
  • C to A, chromosome 6 at 130,065,272 bp
  • A to T, chromosome 7 at 45,712,090 bp
  • A to G, chromosome 7 at 109,934,691 bp
  • A to T, chromosome 7 at 118,669,291 bp
  • T to A, chromosome 8 at 3,679,303 bp
  • GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTACACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG to GCACACAGCTTTGGAGGTGTACACACCCGGGTTGGGGCCTCTGCACACAGCTTTGG, chromosome 8 at 15,042,160 bp
  • A to G, chromosome 8 at 110,538,474 bp
  • T to C, chromosome 9 at 21,802,836 bp
  • T to C, chromosome 9 at 99,320,322 bp
  • T to C, chromosome 10 at 20,959,915 bp
  • T to C, chromosome 10 at 24,181,556 bp
  • G to A, chromosome 10 at 42,275,282 bp
  • T to A, chromosome 10 at 128,438,353 bp
  • C to T, chromosome 11 at 75,445,434 bp
  • T to A, chromosome 11 at 75,491,774 bp
  • G to T, chromosome 11 at 97,685,863 bp
  • T to C, chromosome 11 at 100,118,850 bp
  • A to C, chromosome 11 at 102,353,257 bp
  • A to G, chromosome 11 at 115,469,719 bp
  • G to T, chromosome 11 at 121,224,215 bp
  • G to T, chromosome 12 at 74,976,605 bp
  • T to C, chromosome 13 at 92,755,100 bp
  • T to A, chromosome 14 at 50,346,337 bp
  • T to C, chromosome 14 at 54,975,948 bp
  • T to C, chromosome 15 at 54,598,430 bp
  • T to G, chromosome 16 at 97,452,787 bp
  • T to A, chromosome 17 at 21,465,373 bp
  • C to T, chromosome 17 at 37,610,058 bp
  • T to C, chromosome 17 at 55,971,616 bp
  • T to A, chromosome 17 at 84,740,067 bp
  • C to T, chromosome 18 at 37,486,153 bp
  • T to C, chromosome 18 at 59,410,058 bp
  • T to C, chromosome 18 at 66,859,095 bp
  • G to A, chromosome 18 at 82,646,215 bp
  • C to T, chromosome 19 at 4,841,873 bp
  • T to C, chromosome 19 at 13,234,292 bp
  • C to T, chromosome 19 at 42,100,712 bp
  • A to G, chromosome 19 at 60,468,197 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8560 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068523-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.