Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8678Btlr/Mmmh
Stock Number:
068533-MU
Citation ID:
RRID:MMRRC_068533-MU
Other Names:
R8678 (G1)
Major Collection:

Strain Information

Calb2
Name: calbindin 2
Synonyms: calretinin, CR
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12308
HGNC: HGNC:1435
Homologene: 1318
Gli1
Name: GLI-Kruppel family member GLI1
Synonyms: Zfp-5, Zfp5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14632
VEGA: 10
HGNC: HGNC:4317
Homologene: 3859
Ppp1r16b
Name: protein phosphatase 1, regulatory subunit 16B
Synonyms: ANKRD4, Wdt4, C130078N17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228852
Homologene: 9194
Nlgn3
Name: neuroligin 3
Synonyms: HNL3, A230085M13Rik, NL3, NLG3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 245537
Homologene: 23133
Arc
Name: activity regulated cytoskeletal-associated protein
Synonyms: Arc3.1, arg 3.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11838
HGNC: HGNC:648
Homologene: 9056
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Slc31a2
Name: solute carrier family 31, member 2
Synonyms: Ctr2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20530
Homologene: 37536
Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Rab3gap2
Name: RAB3 GTPase activating protein subunit 2
Synonyms: 1110059F07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 98732
Homologene: 40842
Wdr7
Name: WD repeat domain 7
Synonyms: TGF-beta resistance associated gene, TRAG
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 104082
VEGA: 18
Homologene: 11408
Dmxl1
Name: Dmx-like 1
Synonyms: C630007L23Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 240283
HGNC: HGNC:2937
Homologene: 21136
Irak4
Name: interleukin-1 receptor-associated kinase 4
Synonyms: NY-REN-64, IRAK-4, 9330209D03Rik, 8430405M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 266632
Homologene: 41109
Tiam1
Name: T cell lymphoma invasion and metastasis 1
Synonyms: D16Ium10, D16Ium10e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 21844
Homologene: 2443
Tank
Name: TRAF family member-associated Nf-kappa B activator
Synonyms: I-TRAF, E430026L09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21353
Homologene: 3081
Abcc5
Name: ATP-binding cassette, sub-family C member 5
Synonyms: Mrp5, Abcc5b, Abcc5a, 2900011L11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 27416
HGNC: HGNC:56
Homologene: 21164
Srf
Name: serum response factor
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20807
VEGA: 17
Homologene: 31135
Ppp1r7
Name: protein phosphatase 1, regulatory subunit 7
Synonyms: SDS22, 2310014J01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66385
HGNC: HGNC:9295
Homologene: 2032
Alg2
Name: ALG2 alpha-1,3/1,6-mannosyltransferase
Synonyms: ALPG2, CDGIi, 1300013N08Rik, 1110018A23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56737
Homologene: 5930
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Tia1
Name: cytotoxic granule-associated RNA binding protein 1
Synonyms: mTIA-1, 2310050N03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21841
Homologene: 20692
Ercc8
Name: excision repaiross-complementing rodent repair deficiency, complementation group 8
Synonyms: 2410022P04Rik, Csa, 4631412O06Rik, 2810431L23Rik, B130065P18Rik, Ckn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71991
HGNC: HGNC:3439
Homologene: 62
Klhl20
Name: kelch-like 20
Synonyms: D930050H05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226541
Homologene: 8699
Mctp2
Name: multiple C2 domains, transmembrane 2
Synonyms: LOC244049
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 244049
Homologene: 69254
Ppp1r13l
Name: protein phosphatase 1, regulatory subunit 13 like
Synonyms: NFkB interacting protein 1, wa3, IASPP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 333654
Homologene: 84635
Nr1d1
Name: nuclear receptor subfamily 1, group D, member 1
Synonyms: rev-erbA(alpha), REV-ERBalpha, A530070C09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217166
HGNC: HGNC:7962
Homologene: 23324
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: calcium release channel isoform 1, Ryr, skrr
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Vps37d
Name: vacuolar protein sorting 37D
Synonyms: Wbscr24
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 194309
Homologene: 45580
Acacb
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100705
HGNC: HGNC:85
Homologene: 74382
Scn7a
Name: sodium channel, voltage-gated, type VII, alpha
Synonyms: Nav2.3, NaG, Nav2, 1110034K09Rik, Scn6a, Nax
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20272
Homologene: 55706
Cyp2c70
Name: cytochrome P450, family 2, subfamily c, polypeptide 70
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226105
Homologene: 120027
Vmn2r3
Name: vomeronasal 2, receptor 3
Synonyms: EG637004
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637004
Cfap44
Name: cilia and flagella associated protein 44
Synonyms: 6330444M21Rik, D16Ertd642e, Wdr52
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 212517
Homologene: 75085
Slc35b1
Name: solute carrier family 35, member B1
Synonyms: Ugalt2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 110172
Homologene: 4252
Galnt16
Name: polypeptide N-acetylgalactosaminyltransferase 16
Synonyms: 5730405L21Rik, Galntl1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 108760
VEGA: 12
Homologene: 18907
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Parp10
Name: poly (ADP-ribose) polymerase family, member 10
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 671535
Homologene: 53133
Mei4
Name: meiotic double-stranded break formation protein 4
Synonyms: 4930486G11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 75033
Homologene: 87251
Mgat3
Name: mannoside acetylglucosaminyltransferase 3
Synonyms: GnT-III, 1110038J12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 17309
VEGA: 15
HGNC: HGNC:7046
Homologene: 31088
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Map1a
Name: microtubule-associated protein 1 A
Synonyms: Mtap-1, Mtap1, 6330416M19Rik, Mtap1a
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17754
HGNC: HGNC:6835
Homologene: 1778
Or8j3b
Name: olfactory receptor family 8 subfamily J member 3B
Synonyms: GA_x6K02T2Q125-47844843-47843896, MOR185-11, Olfr1057
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 404325
Homologene: 83135
Pramel26
Name: PRAME like 26
Synonyms: Gm13084
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381569
Homologene: 77858
Nfe2l3
Name: nuclear factor, erythroid derived 2, like 3
Synonyms: Nrf3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18025
HGNC: HGNC:7783
Homologene: 3168
Aoc1l1
Name: amine oxidase copper containing 1-like 1
Synonyms: Doxl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243376
HGNC: HGNC:80
Homologene: 19443
Vmn2r4
Name: vomeronasal 2, receptor 4
Synonyms: EG637053
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 637053
Homologene: 129754
Or2ag2
Name: olfactory receptor family 2 subfamily AG member 2
Synonyms: GA_x6K02T2PBJ9-9271198-9270248, MOR283-11, Olfr706
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258350
Homologene: 133646
Plch1
Name: phospholipase C, eta 1
Synonyms: PLCeta1, Plcl3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 269437
Homologene: 88833
Xkr5
Name: X-linked Kx blood group related 5
Synonyms: 5430438H03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319581
Homologene: 52219
Rbm44
Name: RNA binding motif protein 44
Synonyms: LOC329207
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329207
Homologene: 66636
Or4c122
Name: olfactory receptor family 4 subfamily C member 122
Synonyms: GA_x6K02T2Q125-50696209-50695274, MOR233-1, Olfr1228
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258973
Homologene: 74217
Fbxw19
Name: F-box and WD-40 domain protein 19
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235612
Homologene: 110776
Pcdhb21
Name: protocadherin beta 21
Synonyms: Pcdhb18, PcdhbU
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93892
Homologene: 134302
Lmtk3
Name: lemur tyrosine kinase 3
Synonyms: Aatyk3, AATYK3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381983
Homologene: 79449
Prss33
Name: serine protease 33
Synonyms: tryptase-6, mT6, Eos
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 353130
Homologene: 77185
Ubash3b
Name: ubiquitin associated and SH3 domain containing, B
Synonyms: 2810457I06Rik, TULA-2, Sts-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72828
Homologene: 13152
Tubg1
Name: tubulin, gamma 1
Synonyms: 1500010O08Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 103733
Homologene: 833
Bnip1
Name: BCL2/adenovirus E1B interacting protein 1
Synonyms: 5930429G21Rik, 2010005M06Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224630
HGNC: HGNC:1082
Homologene: 930
Fank1
Name: fibronectin type 3 and ankyrin repeat domains 1
Synonyms: 1700007B22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66930
Homologene: 12055
Zc2hc1c
Name: zinc finger, C2HC-type containing 1C
Synonyms: 2810002I04Rik, Fam164c
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 72350
Homologene: 23461
Nat8f1
Name: N-acetyltransferase 8 (GCN5-related) family member 1
Synonyms: 1110002I11Rik, Cml1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66116
Homologene: 41446
Slfn9
Name: schlafen 9
Synonyms: 9830137M10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237886
Homologene: 45432
Dnaaf3
Name: dynein, axonemal assembly factor 3
Synonyms: 6030429G01Rik, b2b1739Clo
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 436022
Homologene: 16205
Cacng4
Name: calcium channel, voltage-dependent, gamma subunit 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 54377
HGNC: HGNC:1408
Homologene: 8674
Eid2b
Name: EP300 interacting inhibitor of differentiation 2B
Synonyms: 3010005C08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434156
Homologene: 51846
Ighv5-8
Name: immunoglobulin heavy variable V5-8
Synonyms: Gm17309
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 777782
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 91,152,381 bp
  • A to G, chromosome 1 at 93,352,642 bp
  • A to T, chromosome 1 at 161,109,427 bp
  • T to G, chromosome 1 at 185,251,084 bp
  • A to G, chromosome 2 at 28,078,349 bp
  • A to G, chromosome 2 at 61,626,943 bp
  • A to G, chromosome 2 at 66,743,697 bp
  • C to T, chromosome 2 at 86,374,725 bp
  • T to A, chromosome 2 at 89,249,007 bp
  • T to C, chromosome 2 at 91,176,265 bp
  • G to T, chromosome 2 at 121,307,256 bp
  • G to A, chromosome 2 at 158,751,178 bp
  • G to A, chromosome 2 at 158,757,022 bp
  • T to A, chromosome 3 at 63,716,047 bp
  • T to C, chromosome 3 at 64,259,475 bp
  • T to A, chromosome 3 at 64,406,970 bp
  • A to G, chromosome 4 at 47,474,108 bp
  • G to A, chromosome 4 at 62,292,659 bp
  • C to A, chromosome 4 at 143,812,006 bp
  • T to A, chromosome 5 at 114,201,971 bp
  • C to A, chromosome 5 at 135,076,532 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • C to T, chromosome 6 at 48,976,224 bp
  • A to G, chromosome 6 at 51,458,173 bp
  • A to G, chromosome 6 at 85,910,756 bp
  • T to A, chromosome 6 at 86,425,703 bp
  • A to T, chromosome 7 at 4,530,815 bp
  • C to A, chromosome 7 at 19,375,772 bp
  • C to T, chromosome 7 at 28,278,055 bp
  • T to A, chromosome 7 at 29,077,064 bp
  • T to C, chromosome 7 at 30,463,859 bp
  • T to A, chromosome 7 at 45,786,551 bp
  • T to C, chromosome 7 at 72,103,207 bp
  • A to G, chromosome 7 at 106,886,073 bp
  • G to A, chromosome 7 at 133,862,228 bp
  • T to C, chromosome 8 at 18,934,032 bp
  • A to T, chromosome 8 at 110,147,643 bp
  • G to A, chromosome 9 at 41,031,489 bp
  • T to A, chromosome 9 at 81,927,585 bp
  • T to C, chromosome 9 at 105,934,352 bp
  • C to A, chromosome 9 at 109,483,308 bp
  • A to G, chromosome 10 at 52,087,902 bp
  • T to C, chromosome 10 at 127,337,391 bp
  • T to A, chromosome 11 at 82,981,544 bp
  • T to C, chromosome 11 at 95,387,820 bp
  • G to C, chromosome 11 at 98,769,247 bp
  • T to G, chromosome 11 at 101,124,438 bp
  • A to G, chromosome 11 at 107,735,099 bp
  • A to G, chromosome 12 at 80,584,048 bp
  • A to T, chromosome 12 at 85,290,310 bp
  • TATACAT to TAT, chromosome 12 at 113,654,963 bp
  • T to C, chromosome 13 at 108,169,493 bp
  • A to G, chromosome 15 at 47,636,453 bp
  • A to G, chromosome 15 at 74,671,690 bp
  • C to A, chromosome 15 at 76,233,399 bp
  • A to T, chromosome 15 at 80,212,271 bp
  • A to G, chromosome 15 at 94,566,785 bp
  • G to T, chromosome 16 at 15,708,932 bp
  • C to T, chromosome 16 at 20,365,935 bp
  • T to A, chromosome 16 at 32,797,419 bp
  • A to T, chromosome 16 at 44,475,273 bp
  • G to T, chromosome 16 at 89,884,821 bp
  • T to C, chromosome 17 at 23,834,749 bp
  • T to A, chromosome 17 at 26,789,949 bp
  • A to G, chromosome 17 at 46,550,899 bp
  • A to G, chromosome 17 at 67,817,103 bp
  • A to G, chromosome 18 at 37,514,886 bp
  • C to T, chromosome 18 at 49,871,692 bp
  • T to A, chromosome 18 at 63,777,697 bp
  • A to T, chromosome 19 at 40,167,572 bp
  • T to C, chromosome X at 101,308,784 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8678 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068533-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.