Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8678Btlr/Mmmh
Stock Number:
068533-MU
Citation ID:
RRID:MMRRC_068533-MU
Other Names:
R8678 (G1)
Major Collection:

Strain Information

Calb2
Name: calbindin 2
Synonyms: calretinin, CR
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12308
HGNC: HGNC:1435
Homologene: 1318
Gli1
Name: GLI-Kruppel family member GLI1
Synonyms: Zfp-5, Zfp5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14632
VEGA: 10
HGNC: HGNC:4317
Homologene: 3859
Ppp1r16b
Name: protein phosphatase 1, regulatory subunit 16B
Synonyms: ANKRD4, Wdt4, C130078N17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228852
Homologene: 9194
Nlgn3
Name: neuroligin 3
Synonyms: HNL3, A230085M13Rik, NL3, NLG3
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 245537
Homologene: 23133
Arc
Name: activity regulated cytoskeletal-associated protein
Synonyms: Arc3.1, arg 3.1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11838
HGNC: HGNC:648
Homologene: 9056
Prkdc
Name: protein kinase, DNA activated, catalytic polypeptide
Synonyms: DNA-PKcs, slip, DNAPDcs, XRCC7, DNA-PK, DOXNPH, dxnph
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 19090
HGNC: HGNC:9413
Homologene: 5037
Slc31a2
Name: solute carrier family 31, member 2
Synonyms: Ctr2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20530
Homologene: 37536
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 91,152,381 bp
  • A to G, chromosome 1 at 93,352,642 bp
  • A to T, chromosome 1 at 161,109,427 bp
  • T to G, chromosome 1 at 185,251,084 bp
  • A to G, chromosome 2 at 28,078,349 bp
  • A to G, chromosome 2 at 61,626,943 bp
  • A to G, chromosome 2 at 66,743,697 bp
  • C to T, chromosome 2 at 86,374,725 bp
  • T to A, chromosome 2 at 89,249,007 bp
  • T to C, chromosome 2 at 91,176,265 bp
  • G to T, chromosome 2 at 121,307,256 bp
  • G to A, chromosome 2 at 158,751,178 bp
  • G to A, chromosome 2 at 158,757,022 bp
  • T to A, chromosome 3 at 63,716,047 bp
  • T to C, chromosome 3 at 64,259,475 bp
  • T to A, chromosome 3 at 64,406,970 bp
  • A to G, chromosome 4 at 47,474,108 bp
  • G to A, chromosome 4 at 62,292,659 bp
  • C to A, chromosome 4 at 143,812,006 bp
  • T to A, chromosome 5 at 114,201,971 bp
  • C to A, chromosome 5 at 135,076,532 bp
  • CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC to CATC, chromosome 6 at 4,756,431 bp
  • C to T, chromosome 6 at 48,976,224 bp
  • A to G, chromosome 6 at 51,458,173 bp
  • A to G, chromosome 6 at 85,910,756 bp
  • T to A, chromosome 6 at 86,425,703 bp
  • A to T, chromosome 7 at 4,530,815 bp
  • C to A, chromosome 7 at 19,375,772 bp
  • C to T, chromosome 7 at 28,278,055 bp
  • T to A, chromosome 7 at 29,077,064 bp
  • T to C, chromosome 7 at 30,463,859 bp
  • T to A, chromosome 7 at 45,786,551 bp
  • T to C, chromosome 7 at 72,103,207 bp
  • A to G, chromosome 7 at 106,886,073 bp
  • G to A, chromosome 7 at 133,862,228 bp
  • T to C, chromosome 8 at 18,934,032 bp
  • A to T, chromosome 8 at 110,147,643 bp
  • G to A, chromosome 9 at 41,031,489 bp
  • T to A, chromosome 9 at 81,927,585 bp
  • T to C, chromosome 9 at 105,934,352 bp
  • C to A, chromosome 9 at 109,483,308 bp
  • A to G, chromosome 10 at 52,087,902 bp
  • T to C, chromosome 10 at 127,337,391 bp
  • T to A, chromosome 11 at 82,981,544 bp
  • T to C, chromosome 11 at 95,387,820 bp
  • G to C, chromosome 11 at 98,769,247 bp
  • T to G, chromosome 11 at 101,124,438 bp
  • A to G, chromosome 11 at 107,735,099 bp
  • A to G, chromosome 12 at 80,584,048 bp
  • A to T, chromosome 12 at 85,290,310 bp
  • TATACAT to TAT, chromosome 12 at 113,654,963 bp
  • T to C, chromosome 13 at 108,169,493 bp
  • A to G, chromosome 15 at 47,636,453 bp
  • A to G, chromosome 15 at 74,671,690 bp
  • C to A, chromosome 15 at 76,233,399 bp
  • A to T, chromosome 15 at 80,212,271 bp
  • A to G, chromosome 15 at 94,566,785 bp
  • G to T, chromosome 16 at 15,708,932 bp
  • C to T, chromosome 16 at 20,365,935 bp
  • T to A, chromosome 16 at 32,797,419 bp
  • A to T, chromosome 16 at 44,475,273 bp
  • G to T, chromosome 16 at 89,884,821 bp
  • T to C, chromosome 17 at 23,834,749 bp
  • T to A, chromosome 17 at 26,789,949 bp
  • A to G, chromosome 17 at 46,550,899 bp
  • A to G, chromosome 17 at 67,817,103 bp
  • A to G, chromosome 18 at 37,514,886 bp
  • C to T, chromosome 18 at 49,871,692 bp
  • T to A, chromosome 18 at 63,777,697 bp
  • A to T, chromosome 19 at 40,167,572 bp
  • T to C, chromosome X at 101,308,784 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8678 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068533-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.