Strain Name:
C57BL/6J-MtgxR8683Btlr/Mmmh
Stock Number:
068538-MU
Citation ID:
RRID:MMRRC_068538-MU
Other Names:
R8683 (G1)
Major Collection:

Strain Information

Hgs
Name: HGF-regulated tyrosine kinase substrate
Synonyms: tn, Hrs
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15239
HGNC: HGNC:4897
Homologene: 37954
Npr1
Name: natriuretic peptide receptor 1
Synonyms: guanylyl cyclase-A, GC-A, NPR-A, NPRA
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Prdm16
Name: PR domain containing 16
Synonyms: line 27, csp1, 5730557K01Rik, Mel1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Ptpra
Name: protein tyrosine phosphatase receptor type A
Synonyms: PTPalpha, Ptpa, RPTPalpha, RPTRalpha, PTP[a]
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19262
HGNC: HGNC:9664
Homologene: 20621
Adgrg1
Name: adhesion G protein-coupled receptor G1
Synonyms: Cyt28, Gpr56
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14766
HGNC: HGNC:4512
Homologene: 4156
Dapk3
Name: death-associated protein kinase 3
Synonyms: ZIP kinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13144
VEGA: 10
HGNC: HGNC:2676
Homologene: 20353
Numa1
Name: nuclear mitotic apparatus protein 1
Synonyms: NuMA, 6720401E04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101706
HGNC: HGNC:8059
Homologene: 38150
Smc3
Name: structural maintenance of chromosomes 3
Synonyms: SmcD, Mmip1, Cspg6, Bamacan
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13006
HGNC: HGNC:2468
Homologene: 3974
Birc6
Name: baculoviral IAP repeat-containing 6
Synonyms: apollon, Bruce, A430032G04Rik, D630005A10Rik, A430040A19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12211
Homologene: 7248
Trappc9
Name: trafficking protein particle complex 9
Synonyms: 4632408O18Rik, TRS130, Nibp, 1810044A24Rik, 2900005P22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 76510
VEGA: 15
Homologene: 81931
Ahctf1
Name: AT hook containing transcription factor 1
Synonyms: 6230412P20Rik, Elys
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226747
Homologene: 9142
Tbc1d5
Name: TBC1 domain family, member 5
Synonyms: 1600014N05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72238
VEGA: 17
Homologene: 8834
Azin1
Name: antizyme inhibitor 1
Synonyms: ODC antizyme inhibitor, Oazi, 1700085L02Rik, Oazin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 54375
Homologene: 22933
Ecpas
Name: Ecm29 proteasome adaptor and scaffold
Synonyms: AI314180
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230249
Homologene: 6056
Cntn2
Name: contactin 2
Synonyms: Tax, TAG-1, axonin, D130012K04Rik, TAG1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21367
HGNC: HGNC:2172
Homologene: 3720
Ifnar1
Name: interferon (alpha and beta) receptor 1
Synonyms: Ifrc, IFN-alpha/betaR, Ifar
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 15975
HGNC: HGNC:5432
Homologene: 524
Adcy1
Name: adenylate cyclase 1
Synonyms: AC1, I-AC, D11Bwg1392e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432530
HGNC: HGNC:232
Homologene: 41419
Aars1
Name: alanyl-tRNA synthetase 1
Synonyms: Aars
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234734
HGNC: HGNC:20
Homologene: 1213
Supt6
Name: SPT6, histone chaperone and transcription elongation factor
Synonyms: Supt6h, 5131400N11Rik, SPT6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20926
Homologene: 40661
Tenm4
Name: teneurin transmembrane protein 4
Synonyms: Doc4, l7Rn3, ELM2, Odz4, l(7)-3Rn, Ten-m4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23966
Homologene: 8034
Adam12
Name: ADAM metallopeptidase domain 12
Synonyms: Mltna, ADAM12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11489
HGNC: HGNC:190
Homologene: 74862
Vegfa
Name: vascular endothelial growth factor A
Synonyms: VPF, VEGF120, VEGF-A, Vegf, VEGF164, VEGF188
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22339
Homologene: 2534
Irf7
Name: interferon regulatory factor 7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54123
HGNC: HGNC:6122
Homologene: 128624
Mcm4
Name: minichromosome maintenance complex component 4
Synonyms: Cdc21, mCdc21, Mcmd4, 19G
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17217
VEGA: 16
HGNC: HGNC:6947
Homologene: 40496
Copg1
Name: coatomer protein complex, subunit gamma 1
Synonyms: D6Ertd71e, D6Wsu16e, Copg
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54161
HGNC: HGNC:2236
Homologene: 56745
Carm1
Name: coactivator-associated arginine methyltransferase 1
Synonyms: Prmt4, m9Bei
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 59035
Homologene: 10990
Dennd2a
Name: DENN domain containing 2A
Synonyms: B930096L08Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209773
Homologene: 35238
Dync2i1
Name: dynein 2 intermediate chain 1
Synonyms: Dync2l1, D430033N04Rik, Wdr60
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217935
VEGA: 12
Homologene: 23067
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Susd4
Name: sushi domain containing 4
Synonyms: E430021N18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 96935
Homologene: 23062
Atp6v0a4
Name: ATPase, H+ transporting, lysosomal V0 subunit A4
Synonyms: V-ATPase alpha 4, Atp6n1b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 140494
HGNC: HGNC:866
Homologene: 39904
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b1565Clo, b2b3491Clo, Mdnah5, b2b1154Clo, b2b1537Clo, Dnahc5, b2b1134Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Avl9
Name: AVL9 cell migration associated
Synonyms: D730049P16Rik, 5830411G16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78937
Homologene: 62425
Ptgdr2
Name: prostaglandin D2 receptor 2
Synonyms: Crth2, PGD2 receptor, Gpr44
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14764
HGNC: HGNC:4502
Homologene: 3508
Tecta
Name: tectorin alpha
Synonyms: [a]-tectorin, Tctna
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21683
Homologene: 3955
Myo1g
Name: myosin IG
Synonyms: E430002D17Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246177
Homologene: 27996
Dclre1b
Name: DNA cross-link repair 1B
Synonyms: Apollo, SNMIB, mSNM1B
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 140917
Homologene: 32553
Obscn
Name: obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF
Synonyms: LOC380698, OTTMUSG00000005786
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380698
Homologene: 70869
Dym
Name: dymeclin
Synonyms: 1810041M12Rik, 4933427L07Rik, C030019K18Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69190
VEGA: 18
Homologene: 69237
Tsbp1
Name: testis expressed basic protein 1
Synonyms: BC051142
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 407788
Homologene: 128168
Rabepk
Name: Rab9 effector protein with kelch motifs
Synonyms: 9530020D24Rik, 8430412M01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227746
Homologene: 48772
Or2t35
Name: olfactory receptor family 2 subfamily T member 35
Synonyms: MOR274-4_i, Olfr721, MOR274-3P, GA_x6K02T2PLTE-6793523-6794528
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 257982
Hoxa2
Name: homeobox A2
Synonyms: Hox-1.11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 15399
HGNC: HGNC:5103
Homologene: 4901
Vmn2r9
Name: vomeronasal 2, receptor 9
Synonyms: EG435864
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 435864
Homologene: 129606
Arg2
Name: arginase type II
Synonyms: AII
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11847
HGNC: HGNC:664
Homologene: 906
Lipo3
Name: lipase, member O3
Synonyms: Lipo1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381236
Homologene: 103863
Sh2b1
Name: SH2B adaptor protein 1
Synonyms: SH2-B, SH2-Bb, Irip, Sh2bpsm1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20399
Homologene: 32122
AW551984
Name: expressed sequence AW551984
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244810
HGNC: HGNC:6658
Actl11
Name: actin-like 11
Synonyms: 4921517D21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67722
Homologene: 69412
Cyp2j12
Name: cytochrome P450, family 2, subfamily j, polypeptide 12
Synonyms: OTTMUSG00000007939, Cyp2j12-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242546
HGNC: HGNC:2634
Homologene: 133195
Or4k2
Name: olfactory receptor family 4 subfamily K member 2
Synonyms: MOR247-1, GA_x6K02T2PMLR-5881670-5880717, Olfr730
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258486
Homologene: 17269
Hdac9
Name: histone deacetylase 9
Synonyms: Hdac7b, Mitr, D030072B18Rik, HDRP
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 79221
Homologene: 128578
Adarb2
Name: adenosine deaminase, RNA-specific, B2
Synonyms: RED2, Adar3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 94191
HGNC: HGNC:227
Homologene: 10276
Ankmy1
Name: ankyrin repeat and MYND domain containing 1
Synonyms: 4930483I10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241158
Homologene: 9561
Ankk1
Name: ankyrin repeat and kinase domain containing 1
Synonyms: 9930020N01Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244859
VEGA: 9
Homologene: 18258
Galnt6
Name: polypeptide N-acetylgalactosaminyltransferase 6
Synonyms: GalNAc-T6
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 207839
HGNC: HGNC:4128
Homologene: 5218
Eif2b4
Name: eukaryotic translation initiation factor 2B, subunit 4 delta
Synonyms: Eif2b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 13667
HGNC: HGNC:3260
Homologene: 5976
Myb
Name: myeloblastosis oncogene
Synonyms: c-myb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17863
HGNC: HGNC:7545
Homologene: 31311
Entpd8
Name: ectonucleoside triphosphate diphosphohydrolase 8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72090
Homologene: 77857
Anxa10
Name: annexin A10
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26359
HGNC: HGNC:534
Homologene: 21409
Pdpr
Name: pyruvate dehydrogenase phosphatase regulatory subunit
Synonyms: 4930402E16Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 319518
Homologene: 9948
Garin2
Name: golgi associated RAB2 interactor 2
Synonyms: 4921509E07Rik, 4930516C23Rik, Fam71d
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70897
Homologene: 49887
Ccr4
Name: C-C motif chemokine receptor 4
Synonyms: CC CKR-4, Cmkbr4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12773
VEGA: 9
HGNC: HGNC:1605
Homologene: 21135
Mmel1
Name: membrane metallo-endopeptidase-like 1
Synonyms: NEPLP beta, NEPLP alpha, SEP, Mell1, Nl1, Nep2, NEPLP gamma
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 27390
Homologene: 22778
Or5g25
Name: olfactory receptor family 5 subfamily G member 25
Synonyms: MOR175-2, Olfr1002, GA_x6K02T2Q125-47127746-47126790
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258566
Homologene: 104131
Npas2
Name: neuronal PAS domain protein 2
Synonyms: MOP4, bHLHe9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18143
HGNC: HGNC:7895
Homologene: 1887
Sparc
Name: secreted acidic cysteine rich glycoprotein
Synonyms: BM-40, osteonectin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20692
Homologene: 31132
Mmaa
Name: methylmalonic aciduria (cobalamin deficiency) type A
Synonyms: 2810018E08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109136
Homologene: 14586
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Mars2
Name: methionine-tRNA synthetase 2 (mitochondrial)
Synonyms: C730026E21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 212679
Homologene: 6009
Gm10340
Name: predicted gene 10340
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100040697
Homologene: 115686
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 39,347,627 bp
  • C to T, chromosome 1 at 55,238,582 bp
  • A to T, chromosome 1 at 92,885,250 bp
  • A to T, chromosome 1 at 132,522,993 bp
  • T to C, chromosome 1 at 179,795,756 bp
  • T to C, chromosome 1 at 182,892,267 bp
  • G to A, chromosome 2 at 25,084,980 bp
  • G to T, chromosome 2 at 34,795,176 bp
  • A to T, chromosome 2 at 85,648,066 bp
  • A to G, chromosome 2 at 130,552,267 bp
  • A to G, chromosome 3 at 90,455,190 bp
  • A to C, chromosome 3 at 103,803,982 bp
  • T to C, chromosome 4 at 58,834,515 bp
  • T to A, chromosome 4 at 96,121,568 bp
  • T to A, chromosome 4 at 144,109,110 bp
  • A to G, chromosome 4 at 154,528,704 bp
  • A to G, chromosome 4 at 154,889,528 bp
  • A to T, chromosome 5 at 31,187,930 bp
  • T to A, chromosome 5 at 108,849,007 bp
  • T to A, chromosome 6 at 38,048,991 bp
  • G to A, chromosome 6 at 39,523,203 bp
  • C to A, chromosome 6 at 52,164,560 bp
  • T to A, chromosome 6 at 56,753,393 bp
  • A to G, chromosome 6 at 87,892,655 bp
  • G to T, chromosome 7 at 96,902,857 bp
  • T to G, chromosome 7 at 101,977,410 bp
  • GGGGACCAGCTCAGCCACGGGGACCAGCTC to GGGGACCAGCTCAGCCACAGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,571 bp
  • T to A, chromosome 7 at 133,890,200 bp
  • C to T, chromosome 7 at 141,263,509 bp
  • T to A, chromosome 8 at 62,057,791 bp
  • C to T, chromosome 8 at 79,267,969 bp
  • C to T, chromosome 8 at 95,009,648 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 8 at 111,042,249 bp
  • T to A, chromosome 8 at 111,123,860 bp
  • A to T, chromosome 9 at 21,586,168 bp
  • G to A, chromosome 9 at 39,599,709 bp
  • T to G, chromosome 9 at 42,366,972 bp
  • T to A, chromosome 9 at 49,417,992 bp
  • T to A, chromosome 9 at 107,928,866 bp
  • T to C, chromosome 9 at 114,492,148 bp
  • T to C, chromosome 10 at 21,150,506 bp
  • T to C, chromosome 10 at 81,190,235 bp
  • C to T, chromosome 11 at 6,517,569 bp
  • T to C, chromosome 11 at 7,161,328 bp
  • A to T, chromosome 11 at 8,871,805 bp
  • A to G, chromosome 11 at 55,401,957 bp
  • T to C, chromosome 11 at 59,076,879 bp
  • A to T, chromosome 11 at 78,217,901 bp
  • T to A, chromosome 11 at 120,475,218 bp
  • T to A, chromosome 12 at 34,390,221 bp
  • TGATGTCACAGATGTCAC to TGATGTCAC, chromosome 12 at 78,715,283 bp
  • C to T, chromosome 12 at 79,150,020 bp
  • G to T, chromosome 12 at 116,229,642 bp
  • T to A, chromosome 13 at 8,757,359 bp
  • T to A, chromosome 14 at 3,134,949 bp
  • T to A, chromosome 14 at 14,407,480 bp
  • A to T, chromosome 14 at 50,186,746 bp
  • A to T, chromosome 15 at 28,289,221 bp
  • G to A, chromosome 15 at 38,493,531 bp
  • A to G, chromosome 15 at 73,012,815 bp
  • A to T, chromosome 15 at 100,694,722 bp
  • C to A, chromosome 16 at 15,635,274 bp
  • T to A, chromosome 16 at 91,499,444 bp
  • C to T, chromosome 16 at 93,771,811 bp
  • A to G, chromosome 16 at 93,773,921 bp
  • A to T, chromosome 17 at 34,448,808 bp
  • A to T, chromosome 17 at 46,031,470 bp
  • A to G, chromosome 17 at 50,984,603 bp
  • G to A, chromosome 17 at 74,609,119 bp
  • T to A, chromosome 18 at 75,230,018 bp
  • T to A, chromosome 19 at 10,940,529 bp
  • G to A, chromosome 19 at 33,782,204 bp
  • T to A, chromosome 19 at 53,641,185 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8683 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068538-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.