Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8683Btlr/Mmmh
Stock Number:
068538-MU
Citation ID:
RRID:MMRRC_068538-MU
Other Names:
R8683 (G1)
Major Collection:

Strain Information

Hgs
Name: HGF-regulated tyrosine kinase substrate
Synonyms: Hrs, tn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 15239
HGNC: HGNC:4897
Homologene: 37954
Npr1
Name: natriuretic peptide receptor 1
Synonyms: NPRA, GC-A, NPR-A, guanylyl cyclase-A
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18160
HGNC: HGNC:7943
Homologene: 37367
Prdm16
Name: PR domain containing 16
Synonyms: Mel1, 5730557K01Rik, line 27, csp1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70673
Homologene: 11139
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Ptpra
Name: protein tyrosine phosphatase receptor type A
Synonyms: RPTRalpha, PTPalpha, PTP[a], Ptpa, RPTPalpha
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19262
HGNC: HGNC:9664
Homologene: 20621
Adgrg1
Name: adhesion G protein-coupled receptor G1
Synonyms: Cyt28, Gpr56
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14766
HGNC: HGNC:4512
Homologene: 4156
Dapk3
Name: death-associated protein kinase 3
Synonyms: ZIP kinase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13144
VEGA: 10
HGNC: HGNC:2676
Homologene: 20353
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 39,347,627 bp
  • C to T, chromosome 1 at 55,238,582 bp
  • A to T, chromosome 1 at 92,885,250 bp
  • A to T, chromosome 1 at 132,522,993 bp
  • T to C, chromosome 1 at 179,795,756 bp
  • T to C, chromosome 1 at 182,892,267 bp
  • G to A, chromosome 2 at 25,084,980 bp
  • G to T, chromosome 2 at 34,795,176 bp
  • A to T, chromosome 2 at 85,648,066 bp
  • A to G, chromosome 2 at 130,552,267 bp
  • A to G, chromosome 3 at 90,455,190 bp
  • A to C, chromosome 3 at 103,803,982 bp
  • T to C, chromosome 4 at 58,834,515 bp
  • T to A, chromosome 4 at 96,121,568 bp
  • T to A, chromosome 4 at 144,109,110 bp
  • A to G, chromosome 4 at 154,528,704 bp
  • A to G, chromosome 4 at 154,889,528 bp
  • A to T, chromosome 5 at 31,187,930 bp
  • T to A, chromosome 5 at 108,849,007 bp
  • T to A, chromosome 6 at 38,048,991 bp
  • G to A, chromosome 6 at 39,523,203 bp
  • C to A, chromosome 6 at 52,164,560 bp
  • T to A, chromosome 6 at 56,753,393 bp
  • A to G, chromosome 6 at 87,892,655 bp
  • G to T, chromosome 7 at 96,902,857 bp
  • T to G, chromosome 7 at 101,977,410 bp
  • GGGGACCAGCTCAGCCACGGGGACCAGCTC to GGGGACCAGCTCAGCCACAGGGACCAGCTCAGCCACGGGGACCAGCTC, chromosome 7 at 126,467,571 bp
  • T to A, chromosome 7 at 133,890,200 bp
  • C to T, chromosome 7 at 141,263,509 bp
  • T to A, chromosome 8 at 62,057,791 bp
  • C to T, chromosome 8 at 79,267,969 bp
  • C to T, chromosome 8 at 95,009,648 bp
  • CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT to CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT, chromosome 8 at 104,309,470 bp
  • A to G, chromosome 8 at 111,042,249 bp
  • T to A, chromosome 8 at 111,123,860 bp
  • A to T, chromosome 9 at 21,586,168 bp
  • G to A, chromosome 9 at 39,599,709 bp
  • T to G, chromosome 9 at 42,366,972 bp
  • T to A, chromosome 9 at 49,417,992 bp
  • T to A, chromosome 9 at 107,928,866 bp
  • T to C, chromosome 9 at 114,492,148 bp
  • T to C, chromosome 10 at 21,150,506 bp
  • T to C, chromosome 10 at 81,190,235 bp
  • C to T, chromosome 11 at 6,517,569 bp
  • T to C, chromosome 11 at 7,161,328 bp
  • A to T, chromosome 11 at 8,871,805 bp
  • A to G, chromosome 11 at 55,401,957 bp
  • T to C, chromosome 11 at 59,076,879 bp
  • A to T, chromosome 11 at 78,217,901 bp
  • T to A, chromosome 11 at 120,475,218 bp
  • T to A, chromosome 12 at 34,390,221 bp
  • TGATGTCACAGATGTCAC to TGATGTCAC, chromosome 12 at 78,715,283 bp
  • C to T, chromosome 12 at 79,150,020 bp
  • G to T, chromosome 12 at 116,229,642 bp
  • T to A, chromosome 13 at 8,757,359 bp
  • T to A, chromosome 14 at 3,134,949 bp
  • T to A, chromosome 14 at 14,407,480 bp
  • A to T, chromosome 14 at 50,186,746 bp
  • A to T, chromosome 15 at 28,289,221 bp
  • G to A, chromosome 15 at 38,493,531 bp
  • A to G, chromosome 15 at 73,012,815 bp
  • A to T, chromosome 15 at 100,694,722 bp
  • C to A, chromosome 16 at 15,635,274 bp
  • T to A, chromosome 16 at 91,499,444 bp
  • C to T, chromosome 16 at 93,771,811 bp
  • A to G, chromosome 16 at 93,773,921 bp
  • A to T, chromosome 17 at 34,448,808 bp
  • A to T, chromosome 17 at 46,031,470 bp
  • A to G, chromosome 17 at 50,984,603 bp
  • G to A, chromosome 17 at 74,609,119 bp
  • T to A, chromosome 18 at 75,230,018 bp
  • T to A, chromosome 19 at 10,940,529 bp
  • G to A, chromosome 19 at 33,782,204 bp
  • T to A, chromosome 19 at 53,641,185 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8683 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068538-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.