Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8703Btlr/Mmmh
Stock Number:
068557-MU
Citation ID:
RRID:MMRRC_068557-MU
Other Names:
R8703 (G1)
Major Collection:

Strain Information

Slc6a12
Name: solute carrier family 6 (neurotransmitter transporter, betaine/GABA), member 12
Synonyms: Gabt2, BGT1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14411
Homologene: 128225
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
Fryl
Name: FRY like transcription coactivator
Synonyms: 2310004H21Rik, 2510002A14Rik, 9030227G01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72313
Homologene: 103956
Zfp638
Name: zinc finger protein 638
Synonyms: Np220, Zfml
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18139
Homologene: 7447
Reps1
Name: RalBP1 associated Eps domain containing protein
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19707
Homologene: 7515
Nup133
Name: nucleoporin 133
Synonyms: 4832420O05Rik, mermaid
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234865
Homologene: 32402
Sh3d19
Name: SH3 domain protein D19
Synonyms: Kryn
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27059
Homologene: 19064
Sema4d
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
Synonyms: semaphorin H, M-sema G, coll-4, CD100, Semcl2, Semaj, Semacl2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20354
Homologene: 21282
Tmem135
Name: transmembrane protein 135
Synonyms: 2810439K08Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72759
Homologene: 11295
Mcm9
Name: minichromosome maintenance 9 homologous recombination repair factor
Synonyms: 9030408O17Rik, Mcmdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71567
VEGA: 10
Homologene: 13546
Tes
Name: testin LIM domain protein
Synonyms: Tes2, Tes1, testin2, testin, D6Ertd352e
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21753
Homologene: 41051
Rab9
Name: RAB9, member RAS oncogene family
Synonyms: SID 99, 2410064E05Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 56382
HGNC: HGNC:9792
Homologene: 20900
Zdhhc5
Name: zinc finger, DHHC domain containing 5
Synonyms: Zisp, 1110032A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228136
Homologene: 9147
Dync1li1
Name: dynein cytoplasmic 1 light intermediate chain 1
Synonyms: LIC-1, 1110053F02Rik, Dnclic1, Dlic1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235661
VEGA: 9
Homologene: 9403
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Slc9b2
Name: solute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2
Synonyms: C80638, NHA2, nha-oc, NHE10, Nhedc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 97086
Homologene: 45381
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Sis
Name: sucrase isomaltase
Synonyms: Si-s, sucrase-isomaltase, 2010204N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69983
Homologene: 37424
Zfand4
Name: zinc finger, AN1-type domain 4
Synonyms: 2810002D23Rik, Anubl1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67492
VEGA: 6
Homologene: 18373
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Skint5
Name: selection and upkeep of intraepithelial T cells 5
Synonyms: OTTMUSG00000008560
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242627
Homologene: 135888
Per2
Name: period circadian clock 2
Synonyms: mPer2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18627
HGNC: HGNC:8846
Homologene: 7885
Usp29
Name: ubiquitin specific peptidase 29
Synonyms: Ocat
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57775
Homologene: 49641
Rims1
Name: regulating synaptic membrane exocytosis 1
Synonyms: RIM1, RIM1a, C030033M19Rik, RIM1alpha
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 116837
Homologene: 128399
Gpr75
Name: G protein-coupled receptor 75
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237716
HGNC: HGNC:4526
Homologene: 4945
Iqcm
Name: IQ motif containing M
Synonyms: 1700007B14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 71831
Homologene: 53050
Ak9
Name: adenylate kinase 9
Synonyms: LOC215946, Akd2, Gm7127, Akd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 633979
Homologene: 67934
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Naalad2
Name: N-acetylated alpha-linked acidic dipeptidase 2
Synonyms: NAALADASE2, NAADALASE2, D9Ertd285e, GCPIII, GCP3, Folh1b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72560
Homologene: 3294
Nrap
Name: nebulin-related anchoring protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18175
HGNC: HGNC:7988
Homologene: 4499
Zfp110
Name: zinc finger protein 110
Synonyms: NRIF, 2900024E01Rik, Nrif1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 65020
Homologene: 129707
Calr3
Name: calreticulin 3
Synonyms: Crt2, 1700031L01Rik, 6330586I20Rik, calsperin
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 73316
Homologene: 57091
Fpr-rs4
Name: formyl peptide receptor, related sequence 4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14291
HGNC: HGNC:3827
Homologene: 130629
Or9i14
Name: olfactory receptor family 9 subfamily I member 14
Synonyms: GA_x6K02T2RE5P-4147744-4146800, MOR211-2, Olfr1499
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258792
Homologene: 17393
Usp9y
Name: ubiquitin specific peptidase 9, Y chromosome
Synonyms: Dffry, Fafl2
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 107868
Homologene: 68408
Or4b1b
Name: olfactory receptor family 4 subfamily B member 1B
Synonyms: GA_x6K02T2Q125-51636504-51635578, MOR227-3, Olfr1272
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258982
HGNC: HGNC:8290
Homologene: 133649
Apol10b
Name: apolipoprotein L 10B
Synonyms: 9130218O11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328561
Homologene: 129975
Lgr5
Name: leucine rich repeat containing G protein coupled receptor 5
Synonyms: Gpr49
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14160
HGNC: HGNC:4504
Homologene: 20807
Or8k28
Name: olfactory receptor family 8 subfamily K member 28
Synonyms: GA_x6K02T2Q125-47925557-47924616, MOR188-8, MOR256-52P, Olfr1066
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257880
Homologene: 79468
Eya4
Name: EYA transcriptional coactivator and phosphatase 4
Synonyms: B130023L16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14051
VEGA: 10
HGNC: HGNC:3522
Homologene: 3025
Dppa3
Name: developmental pluripotency-associated 3
Synonyms: PGC7, 2410075G02Rik, stella
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73708
Homologene: 138189
Slc22a7
Name: solute carrier family 22 (organic anion transporter), member 7
Synonyms: OAT2, NLT
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 108114
VEGA: 17
Homologene: 21328
Sirt6
Name: sirtuin 6
Synonyms: 2810449N18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 50721
Homologene: 6924
Spata21
Name: spermatogenesis associated 21
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329972
Homologene: 18639
Rpl10-ps3
Name: ribosomal protein L10, pseudogene 3
Synonyms: Gm10041
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100043346
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 22,425,887 bp
  • T to A, chromosome 1 at 91,424,045 bp
  • T to A, chromosome 1 at 181,666,011 bp
  • A to T, chromosome 2 at 82,991,527 bp
  • T to C, chromosome 2 at 84,690,252 bp
  • C to A, chromosome 2 at 86,455,900 bp
  • T to A, chromosome 2 at 90,296,493 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 3 at 72,960,324 bp
  • A to G, chromosome 3 at 86,107,261 bp
  • C to A, chromosome 3 at 135,326,163 bp
  • T to A, chromosome 4 at 113,876,010 bp
  • A to G, chromosome 4 at 141,104,907 bp
  • T to C, chromosome 5 at 73,090,654 bp
  • C to G, chromosome 6 at 17,099,789 bp
  • T to A, chromosome 6 at 83,977,161 bp
  • A to G, chromosome 6 at 116,273,643 bp
  • A to G, chromosome 6 at 121,347,488 bp
  • A to T, chromosome 6 at 122,628,778 bp
  • T to C, chromosome 7 at 6,961,322 bp
  • T to A, chromosome 7 at 12,848,961 bp
  • G to A, chromosome 7 at 89,158,962 bp
  • T to C, chromosome 8 at 33,572,696 bp
  • A to T, chromosome 8 at 72,438,447 bp
  • G to T, chromosome 8 at 75,888,643 bp
  • A to G, chromosome 8 at 123,916,282 bp
  • A to C, chromosome 9 at 18,378,712 bp
  • A to G, chromosome 9 at 50,344,884 bp
  • C to A, chromosome 9 at 114,723,261 bp
  • C to A, chromosome 10 at 8,729,831 bp
  • C to T, chromosome 10 at 18,093,242 bp
  • A to G, chromosome 10 at 23,163,442 bp
  • A to T, chromosome 10 at 41,325,124 bp
  • G to A, chromosome 10 at 53,629,977 bp
  • A to G, chromosome 10 at 81,625,714 bp
  • A to G, chromosome 10 at 115,452,705 bp
  • A to C, chromosome 11 at 30,891,890 bp
  • T to C, chromosome 13 at 51,700,923 bp
  • G to A, chromosome 13 at 81,528,673 bp
  • T to A, chromosome 15 at 77,588,697 bp
  • T to A, chromosome 17 at 18,022,070 bp
  • T to C, chromosome 17 at 46,434,025 bp
  • G to T, chromosome 19 at 13,814,741 bp
  • C to T, chromosome 19 at 56,335,271 bp
  • C to T, chromosome X at 166,457,758 bp
  • A to G, chromosome Y at 1,356,317 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8703 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068557-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.