Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8728Btlr/Mmmh
Stock Number:
068576-MU
Citation ID:
RRID:MMRRC_068576-MU
Other Names:
R8728 (G1)
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Rnf38
Name: ring finger protein 38
Synonyms: Oip1, 1700065B19Rik, 2610202O07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73469
Homologene: 32550
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Ttc39b
Name: tetratricopeptide repeat domain 39B
Synonyms: 9130422G05Rik, 1810054D07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69863
Homologene: 25228
Bms1
Name: BMS1, ribosome biogenesis factor
Synonyms: Bms1l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213895
Homologene: 7065
Bltp3b
Name: bridge-like lipid transfer protein family member 3B
Synonyms: 4930506D01Rik, 2010319N22Rik, E030041M21Rik, Uhrf1bp1l
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75089
VEGA: 10
Homologene: 12590
Mical3
Name: microtubule associated monooxygenase, calponin and LIM domain containing 3
Synonyms: MICAL-3, C130040D16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 194401
Homologene: 85288
Stat1
Name: signal transducer and activator of transcription 1
Synonyms: 2010005J02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20846
Homologene: 21428
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: 5033413A03Rik, SRm300
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Afdn
Name: afadin, adherens junction formation factor
Synonyms: AF6, Afadin, S-afadin, I-afadin, 5033403D15Rik, Mllt4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17356
HGNC: HGNC:7137
Homologene: 21202
Bloc1s6
Name: biogenesis of lysosomal organelles complex-1, subunit 6, pallidin
Synonyms: BLOC-1 subunit, BLOC-1, Pldn
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18457
HGNC: HGNC:8549
Homologene: 40841
Lmnb2
Name: lamin B2
Synonyms: lamin B3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16907
HGNC: HGNC:6638
Homologene: 7818
Iws1
Name: IWS1, SUPT6 interacting protein
Synonyms: 1700069O15Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 73473
Homologene: 134421
Impdh2
Name: inosine monophosphate dehydrogenase 2
Synonyms: IMP dehydrogenase type II
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23918
HGNC: HGNC:6053
Homologene: 48919
Tcf20
Name: transcription factor 20
Synonyms: SPBP, stromelysin 1 PDGF responsive element binding protein, 2810438H08Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21411
VEGA: 15
Homologene: 4131
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Rasa3
Name: RAS p21 protein activator 3
Synonyms: GAPIII activator 3, Ras GTPase-activating protein III, GAPIII, R-Ras gap, scat, hlb381
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 19414
Homologene: 7217
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Dcbld1
Name: discoidin, CUB and LCCL domain containing 1
Synonyms: 4631413K11Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 66686
Homologene: 12010
Zfand2a
Name: zinc finger, AN1-type domain 2A
Synonyms: Airap
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100494
Homologene: 64373
Ddr2
Name: discoidin domain receptor family, member 2
Synonyms: Ntrkr3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18214
HGNC: HGNC:2731
Homologene: 68505
Anxa9
Name: annexin A9
Synonyms: 2310069F17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 71790
HGNC: HGNC:547
Homologene: 2643
Muc4
Name: mucin 4
Synonyms: 4933405I11Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 140474
HGNC: HGNC:7514
Homologene: 124469
Trak2
Name: trafficking protein, kinesin binding 2
Synonyms: GRIF-1, CALS-C, OIP98, GRIF1, 4733401O11Rik, Als2cr3, 2900022D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70827
Homologene: 22861
Kctd18
Name: potassium channel tetramerisation domain containing 18
Synonyms: 4932411A20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 51960
Homologene: 12710
Vwa7
Name: von Willebrand factor A domain containing 7
Synonyms: G7c, D17H6S56E-3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27762
Homologene: 11895
Galnt18
Name: polypeptide N-acetylgalactosaminyltransferase 18
Synonyms: 2900011G21Rik, Galntl4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233733
Homologene: 18347
Pnldc1
Name: poly(A)-specific ribonuclease (PARN)-like domain containing 1
Synonyms: LOC240023
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240023
VEGA: 17
Homologene: 15054
Mroh2b
Name: maestro heat-like repeat family member 2B
Synonyms: 4930455B06Rik, Heatr7b2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223825
VEGA: 15
Homologene: 128807
Wdr64
Name: WD repeat domain 64
Synonyms: 4930415O10Rik, 4930511H01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75820
Homologene: 51634
Col19a1
Name: collagen, type XIX, alpha 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12823
HGNC: HGNC:2196
Homologene: 55608
Ak9
Name: adenylate kinase 9
Synonyms: LOC215946, Akd2, Gm7127, Akd1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 633979
Homologene: 67934
Plekhh1
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 1
Synonyms: D630024D12Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 211945
VEGA: 12
Homologene: 121939
Krt78
Name: keratin 78
Synonyms: 2310030B04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 332131
VEGA: 15
Homologene: 65261
Krt13
Name: keratin 13
Synonyms: Krt-1.13, K13, Krt1-13
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16663
HGNC: HGNC:6415
Homologene: 40740
Adam2
Name: a disintegrin and metallopeptidase domain 2
Synonyms: Ph30-beta, Ftnb, fertilin beta
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 11495
VEGA: 14
HGNC: HGNC:198
Homologene: 1127
Celsr3
Name: cadherin, EGF LAG seven-pass G-type receptor 3
Synonyms: Fmi1, flamingo, Adgrc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 107934
HGNC: HGNC:3230
Homologene: 1077
Fam83a
Name: family with sequence similarity 83, member A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239463
Homologene: 13158
Atp6v0a2
Name: ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms: TJ6s, Tj6, ATP6a2, Atp6n2, 8430408C20Rik, V-ATPase a2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21871
Homologene: 56523
Myrfl
Name: myelin regulatory factor-like
Synonyms: LOC237558, Gm239
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237558
VEGA: 10
Homologene: 88588
Tmf1
Name: TATA element modulatory factor 1
Synonyms: LOC232286, 7030402D04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232286
Homologene: 133801
Sema5a
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
Synonyms: M-Sema D, semF, Semaf, 9130201M22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20356
VEGA: 15
Homologene: 2949
Cyp3a59
Name: cytochrome P450, family 3, subfamily a, polypeptide 59
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100041449
Homologene: 135775
Cnnm1
Name: cyclin M1
Synonyms: Acdp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 83674
VEGA: 19
HGNC: HGNC:102
Homologene: 10673
Vmn1r30
Name: vomeronasal 1 receptor 30
Synonyms: V1rc9, V1rc22
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171195
Homologene: 137652
Lrrc27
Name: leucine rich repeat containing 27
Synonyms: 1700071K18Rik, 2310044E02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76612
Homologene: 19268
Ces1b
Name: carboxylesterase 1B
Synonyms: Gm5158
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382044
Homologene: 117484
Cyp4a31
Name: cytochrome P450, family 4, subfamily a, polypeptide 31
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 666168
Homologene: 128044
Or10al6
Name: olfactory receptor family 10 subfamily AL member 6
Synonyms: MOR263-10, GA_x6K02T2PSCP-2230932-2231897, Olfr122
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258285
Homologene: 122777
Cdk14
Name: cyclin dependent kinase 14
Synonyms: Pftk1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18647
HGNC: HGNC:8883
Homologene: 7888
Dagla
Name: diacylglycerol lipase, alpha
Synonyms: Nsddr
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 269060
HGNC: HGNC:1165
Homologene: 4468
Cyp2c67
Name: cytochrome P450, family 2, subfamily c, polypeptide 67
Synonyms: C730004C24Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 545288
HGNC: HGNC:2622
Homologene: 74936
Tgm2
Name: transglutaminase 2, C polypeptide
Synonyms: tissue transglutaminase, protein-glutamine gamma-glutamyltransferase, G[a]h, TG C, tTGas, tTG, TG2, TGase2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 21817
Homologene: 3391
Zfp865
Name: zinc finger protein 865
Synonyms: 6430526N21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319748
Homologene: 19652
Sesn1
Name: sestrin 1
Synonyms: 1110002G11Rik, SEST1, PA26
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140742
Homologene: 8697
Rbm4b
Name: RNA binding motif protein 4B
Synonyms: 4921506I22Rik, Lark2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66704
Homologene: 57033
Hdac1-ps
Name: histone deacetylase 1, pseudogene
Synonyms: EG15181, Gm10093
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15181
VEGA: 17
Gm9944
Name: predicted gene 9944
Type: Gene
Species: Mouse
Chromosome: 4
Ccdc9b
Name: coiled-coil domain containing 9B
Synonyms: A430105I19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214239
Homologene: 128188
Or2t48
Name: olfactory receptor family 2 subfamily T member 48
Synonyms: GA_x6K02T2NKPP-895420-896349, MOR275-1, Olfr330
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258879
Homologene: 133015
Cym
Name: chymosin
Synonyms: LOC229697, Gm131
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229697
HGNC: HGNC:2588
Homologene: 129841
Lrrc72
Name: leucine rich repeat containing 72
Synonyms: 4933421E18Rik, 1700108M19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71156
Homologene: 90358
Six4
Name: sine oculis-related homeobox 4
Synonyms: AREC3, TrexBF
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20474
Homologene: 69089
Pbp2
Name: phosphatidylethanolamine binding protein 2
Synonyms: Pebp-2, 1700023A18Rik, Pebp2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76400
HGNC: HGNC:8630
Homologene: 135930
Malrd1
Name: MAM and LDL receptor class A domain containing 1
Synonyms: Diet1, Gm13318, Gm13364
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102635496
Homologene: 136214
Krtap4-7
Name: keratin associated protein 4-7
Synonyms: KRTAP4.7, KAP4.7, 2310037K05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76444
Homologene: 137394
Gm43302
Name: predicted gene 43302
Type: Gene
Species: Mouse
Chromosome: 5
Psmb5
Name: proteasome (prosome, macropain) subunit, beta type 5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19173
VEGA: 14
HGNC: HGNC:9542
Homologene: 55690
Krtap5-22
Name: keratin associated protein 5-22
Synonyms: Krtap5-22, Gm29735
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101055862
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 24,326,032 bp
  • G to A, chromosome 1 at 52,139,194 bp
  • G to T, chromosome 1 at 57,963,130 bp
  • A to G, chromosome 1 at 58,935,775 bp
  • T to C, chromosome 1 at 170,001,983 bp
  • A to T, chromosome 1 at 175,731,513 bp
  • T to A, chromosome 2 at 15,696,942 bp
  • T to C, chromosome 2 at 118,757,312 bp
  • A to T, chromosome 2 at 122,746,106 bp
  • T to C, chromosome 2 at 158,120,145 bp
  • T to C, chromosome 3 at 95,302,668 bp
  • A to G, chromosome 3 at 107,218,675 bp
  • A to G, chromosome 4 at 44,131,615 bp
  • A to G, chromosome 4 at 83,253,010 bp
  • G to A, chromosome 4 at 115,565,028 bp
  • T to C, chromosome 4 at 144,453,031 bp
  • G to A, chromosome 5 at 5,420,117 bp
  • T to C, chromosome 5 at 105,290,927 bp
  • T to C, chromosome 5 at 124,719,088 bp
  • C to T, chromosome 5 at 139,481,998 bp
  • G to A, chromosome 5 at 146,098,312 bp
  • A to G, chromosome 6 at 58,435,475 bp
  • A to T, chromosome 6 at 97,156,860 bp
  • A to G, chromosome 6 at 118,392,370 bp
  • C to A, chromosome 6 at 120,973,553 bp
  • T to C, chromosome 6 at 135,310,106 bp
  • G to C, chromosome 7 at 5,031,820 bp
  • T to A, chromosome 7 at 111,520,036 bp
  • A to T, chromosome 7 at 139,242,639 bp
  • ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA to ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA, chromosome 7 at 142,156,529 bp
  • C to T, chromosome 8 at 13,586,873 bp
  • A to T, chromosome 8 at 93,071,948 bp
  • C to T, chromosome 9 at 7,502,479 bp
  • C to T, chromosome 9 at 106,846,806 bp
  • C to T, chromosome 9 at 108,560,363 bp
  • T to C, chromosome 9 at 108,846,741 bp
  • G to A, chromosome 10 at 41,406,963 bp
  • G to T, chromosome 10 at 41,903,775 bp
  • T to C, chromosome 10 at 52,233,833 bp
  • A to G, chromosome 10 at 80,905,079 bp
  • A to T, chromosome 10 at 89,782,720 bp
  • A to T, chromosome 10 at 116,798,640 bp
  • T to C, chromosome 11 at 58,529,201 bp
  • C to T, chromosome 11 at 62,330,859 bp
  • C to G, chromosome 11 at 99,643,962 bp
  • T to G, chromosome 11 at 100,121,492 bp
  • G to A, chromosome 12 at 36,208,657 bp
  • A to G, chromosome 12 at 73,112,406 bp
  • C to A, chromosome 12 at 79,069,088 bp
  • A to T, chromosome 14 at 54,617,804 bp
  • A to G, chromosome 14 at 66,057,637 bp
  • T to C, chromosome 15 at 4,905,640 bp
  • T to C, chromosome 15 at 32,562,557 bp
  • T to A, chromosome 15 at 58,009,666 bp
  • T to G, chromosome 15 at 82,081,981 bp
  • A to T, chromosome 15 at 82,854,957 bp
  • C to T, chromosome 15 at 94,331,400 bp
  • A to T, chromosome 15 at 101,947,790 bp
  • A to T, chromosome 16 at 32,754,952 bp
  • A to T, chromosome 17 at 12,897,278 bp
  • A to G, chromosome 17 at 13,898,945 bp
  • G to A, chromosome 17 at 23,819,857 bp
  • T to A, chromosome 17 at 35,017,157 bp
  • C to A, chromosome 17 at 37,771,751 bp
  • T to C, chromosome 17 at 67,818,668 bp
  • A to G, chromosome 17 at 78,492,903 bp
  • G to A, chromosome 18 at 32,083,281 bp
  • G to A, chromosome 19 at 4,762,191 bp
  • G to A, chromosome 19 at 10,248,407 bp
  • T to G, chromosome 19 at 39,626,161 bp
  • A to G, chromosome 19 at 43,484,926 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8728 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068576-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.