Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8728Btlr/Mmmh
Stock Number:
068576-MU
Citation ID:
RRID:MMRRC_068576-MU
Other Names:
R8728 (G1)
Major Collection:

Strain Information

Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Rnf38
Name: ring finger protein 38
Synonyms: Oip1, 1700065B19Rik, 2610202O07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 73469
Homologene: 32550
Dcaf1
Name: DDB1 and CUL4 associated factor 1
Synonyms: B930007L02Rik, Vprbp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 321006
Homologene: 8805
Ttc39b
Name: tetratricopeptide repeat domain 39B
Synonyms: 9130422G05Rik, 1810054D07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69863
Homologene: 25228
Bms1
Name: BMS1, ribosome biogenesis factor
Synonyms: Bms1l
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 213895
Homologene: 7065
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 24,326,032 bp
  • G to A, chromosome 1 at 52,139,194 bp
  • G to T, chromosome 1 at 57,963,130 bp
  • A to G, chromosome 1 at 58,935,775 bp
  • T to C, chromosome 1 at 170,001,983 bp
  • A to T, chromosome 1 at 175,731,513 bp
  • T to A, chromosome 2 at 15,696,942 bp
  • T to C, chromosome 2 at 118,757,312 bp
  • A to T, chromosome 2 at 122,746,106 bp
  • T to C, chromosome 2 at 158,120,145 bp
  • T to C, chromosome 3 at 95,302,668 bp
  • A to G, chromosome 3 at 107,218,675 bp
  • A to G, chromosome 4 at 44,131,615 bp
  • A to G, chromosome 4 at 83,253,010 bp
  • G to A, chromosome 4 at 115,565,028 bp
  • T to C, chromosome 4 at 144,453,031 bp
  • G to A, chromosome 5 at 5,420,117 bp
  • T to C, chromosome 5 at 105,290,927 bp
  • T to C, chromosome 5 at 124,719,088 bp
  • C to T, chromosome 5 at 139,481,998 bp
  • G to A, chromosome 5 at 146,098,312 bp
  • A to G, chromosome 6 at 58,435,475 bp
  • A to T, chromosome 6 at 97,156,860 bp
  • A to G, chromosome 6 at 118,392,370 bp
  • C to A, chromosome 6 at 120,973,553 bp
  • T to C, chromosome 6 at 135,310,106 bp
  • G to C, chromosome 7 at 5,031,820 bp
  • T to A, chromosome 7 at 111,520,036 bp
  • A to T, chromosome 7 at 139,242,639 bp
  • ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA to ACAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCAACAGCAGGATTCGCAGCAGCAGGGCTTGCAGCAGCTGGACTGGCAGCAGCAAGGCTTGCAGCAGCTGGACTGGCAGCAGCAGGGCTTGCA, chromosome 7 at 142,156,529 bp
  • C to T, chromosome 8 at 13,586,873 bp
  • A to T, chromosome 8 at 93,071,948 bp
  • C to T, chromosome 9 at 7,502,479 bp
  • C to T, chromosome 9 at 106,846,806 bp
  • C to T, chromosome 9 at 108,560,363 bp
  • T to C, chromosome 9 at 108,846,741 bp
  • G to A, chromosome 10 at 41,406,963 bp
  • G to T, chromosome 10 at 41,903,775 bp
  • T to C, chromosome 10 at 52,233,833 bp
  • A to G, chromosome 10 at 80,905,079 bp
  • A to T, chromosome 10 at 89,782,720 bp
  • A to T, chromosome 10 at 116,798,640 bp
  • T to C, chromosome 11 at 58,529,201 bp
  • C to T, chromosome 11 at 62,330,859 bp
  • C to G, chromosome 11 at 99,643,962 bp
  • T to G, chromosome 11 at 100,121,492 bp
  • G to A, chromosome 12 at 36,208,657 bp
  • A to G, chromosome 12 at 73,112,406 bp
  • C to A, chromosome 12 at 79,069,088 bp
  • A to T, chromosome 14 at 54,617,804 bp
  • A to G, chromosome 14 at 66,057,637 bp
  • T to C, chromosome 15 at 4,905,640 bp
  • T to C, chromosome 15 at 32,562,557 bp
  • T to A, chromosome 15 at 58,009,666 bp
  • T to G, chromosome 15 at 82,081,981 bp
  • A to T, chromosome 15 at 82,854,957 bp
  • C to T, chromosome 15 at 94,331,400 bp
  • A to T, chromosome 15 at 101,947,790 bp
  • A to T, chromosome 16 at 32,754,952 bp
  • A to T, chromosome 17 at 12,897,278 bp
  • A to G, chromosome 17 at 13,898,945 bp
  • G to A, chromosome 17 at 23,819,857 bp
  • T to A, chromosome 17 at 35,017,157 bp
  • C to A, chromosome 17 at 37,771,751 bp
  • T to C, chromosome 17 at 67,818,668 bp
  • A to G, chromosome 17 at 78,492,903 bp
  • G to A, chromosome 18 at 32,083,281 bp
  • G to A, chromosome 19 at 4,762,191 bp
  • G to A, chromosome 19 at 10,248,407 bp
  • T to G, chromosome 19 at 39,626,161 bp
  • A to G, chromosome 19 at 43,484,926 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8728 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068576-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.