Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8789Btlr/Mmmh
Stock Number:
068608-MU
Citation ID:
RRID:MMRRC_068608-MU
Other Names:
R8789 (G1)
Major Collection:

Strain Information

Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Elp3
Name: elongator acetyltransferase complex subunit 3
Synonyms: 2610507P14Rik, KAT9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74195
VEGA: 14
Homologene: 7105
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Ccdc93
Name: coiled-coil domain containing 93
Synonyms: 9230102M16Rik, 4633402D15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70829
Homologene: 10393
R3hdm2
Name: R3H domain containing 2
Synonyms: 1300003K24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71750
Homologene: 8954
Dmac2
Name: distal membrane arm assembly complex 2
Synonyms: C030044E10Rik, 2310004L02Rik, Atp5sl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66349
Homologene: 9973
Ctr9
Name: CTR9 homolog, Paf1/RNA polymerase II complex component
Synonyms: Tsp, Tsbp, Sh2bp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22083
Homologene: 40668
Cd72
Name: CD72 antigen
Synonyms: Ly-19, Ly-m19, Ly-32, Lyb-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12517
HGNC: HGNC:1696
Homologene: 1350
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Ubr4
Name: ubiquitin protein ligase E3 component n-recognin 4
Synonyms: A930005E13Rik, LOC381562, D930005K06Rik, 1810009A16Rik, Zubr1, p600
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69116
Homologene: 10804
Phrf1
Name: PHD and ring finger domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 101471
Homologene: 16377
Klrb1c
Name: killer cell lectin-like receptor subfamily B member 1C
Synonyms: Nkrp1-c, NK-RP1, Nk1.1, CD161, NK-1.1, Ly-59, Nk-1, Ly55c, Nk-1.2, NKR-P1, Nk1, Ly59, NKR-P1C
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 17059
HGNC: HGNC:6373
Homologene: 84369
Hapstr1
Name: HUWE1 associated protein modifying stress responses
Synonyms: 1810013L24Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69053
VEGA: 16
Homologene: 105712
Tsc22d2
Name: TSC22 domain family, member 2
Synonyms: 1810043J12Rik, 5530402M19Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72033
Homologene: 8860
Cep72
Name: centrosomal protein 72
Synonyms: 2610029E11Rik, 4933440J22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74470
VEGA: 13
Homologene: 10027
Pym1
Name: PYM homolog 1, exon junction complex associated factor
Synonyms: PYM Protein, Pym, A030010B05Rik, Wibg
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 78428
VEGA: 10
Homologene: 41788
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Grk2
Name: G protein-coupled receptor kinase 2
Synonyms: beta ARK, beta ARK1, beta-AR kinase-1, beta-adrenergic receptor kinase-1, Bark-1, Adrbk-1, betaARK1, Adrbk1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 110355
HGNC: HGNC:289
Homologene: 1223
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Serpinb6e
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6e
Synonyms: ovalbumin, SPI3B, Gm11396
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 435350
HGNC: HGNC:8950
Homologene: 50933
Cyp2j11
Name: cytochrome P450, family 2, subfamily j, polypeptide 11
Synonyms: Cyp2j11-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100066
HGNC: HGNC:2634
Homologene: 133819
Gm10800
Name: predicted gene 10800
Type: Gene
Species: Mouse
Chromosome: 2
Ros1
Name: Ros1 proto-oncogene
Synonyms: Ros-1, c-ros
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19886
Homologene: 2207
Arsa
Name: arylsulfatase A
Synonyms: As-2, ASA, As2, AS-A
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11883
HGNC: HGNC:713
Homologene: 20138
Itgal
Name: integrin alpha L
Synonyms: LFA-1, Cd11a, Ly-21, Ly-15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16408
HGNC: HGNC:6148
Homologene: 1666
Crybg2
Name: crystallin beta-gamma domain containing 2
Synonyms: Aim1l
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230806
Homologene: 19232
Ubtfl1
Name: upstream binding transcription factor, RNA polymerase I-like 1
Synonyms: B020006M18Rik, Hmgpi
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546118
Homologene: 110115
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Cyp4f39
Name: cytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms: 4732474A20Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320997
VEGA: 17
Homologene: 69814
Cers5
Name: ceramide synthase 5
Synonyms: 2310081H14Rik, Trh4, CerS5, Lass5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71949
Homologene: 23634
Gm10912
Name: predicted gene 10912
Type: Gene
Species: Mouse
Chromosome: 2
Psg26
Name: pregnancy-specific beta-1-glycoprotein 26
Synonyms: cea14, EG574429
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 574429
Homologene: 110989
Cntn5
Name: contactin 5
Synonyms: LOC244683, NB-2, A830025P08Rik, 6720426O10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244682
HGNC: HGNC:2175
Homologene: 28447
Foxg1
Name: forkhead box G1
Synonyms: BF-1, Hfh9, Hfhbf1, Bf1, 2900064B05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15228
HGNC: HGNC:3811
Homologene: 3843
Scg2
Name: secretogranin II
Synonyms: SgII, Chgc
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20254
Homologene: 2591
Rnf207
Name: ring finger protein 207
Synonyms: D330010C22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 433809
Homologene: 19234
Cyp2a4
Name: cytochrome P450, family 2, subfamily a, polypeptide 4
Synonyms: Cyp15a1, D7Ucla4, testosterone 15alpha-hydroxylase
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13086
Homologene: 85917
Htra3
Name: HtrA serine peptidase 3
Synonyms: 9530081K03Rik, 2210021K23Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78558
Homologene: 12697
Pmp2
Name: peripheral myelin protein 2
Synonyms: P2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18857
HGNC: HGNC:9117
Homologene: 20589
Duxf1
Name: double homeobox family member 1
Synonyms: AW822073
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100504180
Homologene: 134545
Actr5
Name: ARP5 actin-related protein 5
Synonyms: B430109J19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109275
Homologene: 6818
Rimkla
Name: ribosomal modification protein rimK-like family member A
Synonyms: Rimk, NAAGS-II
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 194237
Homologene: 18336
Hoxc12
Name: homeobox C12
Synonyms: Hox-3.8
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15421
HGNC: HGNC:5124
Homologene: 7769
Or2z9
Name: olfactory receptor family 2 subfamily Z member 9
Synonyms: GA_x6K02T2NUPS-231686-232630, MOR282-1, MOR282-2, Olfr373
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 258532
Homologene: 17287
Or13c7d
Name: olfactory receptor family 13 subfamily C member 7D
Synonyms: mOR37e, Olfr37e, MOR262-5, GA_x6K02T2N78B-16165641-16166600, Olfr159
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 29849
Homologene: 128097
Zscan4-ps3
Name: zinc finger and SCAN domain containing 4, pseudogene 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043042
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 79,435,783 bp
  • A to G, chromosome 1 at 121,497,055 bp
  • T to C, chromosome 2 at 82,985,478 bp
  • CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA to CAAGAAAACTGAAAATCA, chromosome 2 at 98,667,016 bp
  • A to C, chromosome 2 at 104,066,701 bp
  • C to T, chromosome 2 at 158,636,684 bp
  • T to A, chromosome 3 at 10,182,504 bp
  • A to T, chromosome 3 at 58,460,017 bp
  • A to G, chromosome 4 at 43,452,628 bp
  • A to T, chromosome 4 at 43,770,793 bp
  • C to T, chromosome 4 at 96,339,168 bp
  • T to C, chromosome 4 at 119,492,410 bp
  • T to C, chromosome 4 at 134,074,243 bp
  • T to A, chromosome 4 at 139,410,183 bp
  • T to C, chromosome 4 at 145,069,173 bp
  • C to T, chromosome 4 at 152,307,467 bp
  • G to A, chromosome 5 at 35,679,258 bp
  • T to C, chromosome 6 at 17,281,997 bp
  • A to G, chromosome 6 at 128,784,185 bp
  • T to C, chromosome 7 at 11,612,361 bp
  • T to C, chromosome 7 at 18,482,569 bp
  • T to A, chromosome 7 at 25,621,070 bp
  • T to A, chromosome 7 at 26,307,681 bp
  • A to G, chromosome 7 at 111,043,726 bp
  • A to G, chromosome 7 at 127,305,249 bp
  • T to A, chromosome 7 at 141,256,668 bp
  • T to A, chromosome 8 at 17,216,706 bp
  • T to C, chromosome 8 at 72,100,291 bp
  • CT to C, chromosome 8 at 104,182,032 bp
  • A to G, chromosome 9 at 9,673,287 bp
  • A to G, chromosome 9 at 18,410,313 bp
  • A to T, chromosome 10 at 52,123,232 bp
  • T to C, chromosome 10 at 58,223,604 bp
  • T to G, chromosome 10 at 127,457,652 bp
  • T to C, chromosome 10 at 128,765,204 bp
  • T to A, chromosome 12 at 49,385,360 bp
  • G to A, chromosome 13 at 33,833,230 bp
  • A to G, chromosome 13 at 74,038,248 bp
  • G to A, chromosome 14 at 65,565,421 bp
  • T to C, chromosome 15 at 76,704,346 bp
  • C to T, chromosome 15 at 89,474,057 bp
  • C to A, chromosome 15 at 99,739,670 bp
  • T to C, chromosome 15 at 102,938,297 bp
  • T to C, chromosome 16 at 8,843,001 bp
  • T to C, chromosome 16 at 59,554,996 bp
  • T to C, chromosome 17 at 32,491,874 bp
  • G to A, chromosome 19 at 4,288,483 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8789 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068608-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.