Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8789Btlr/Mmmh
Stock Number:
068608-MU
Citation ID:
RRID:MMRRC_068608-MU
Other Names:
R8789 (G1)
Major Collection:

Strain Information

Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Elp3
Name: elongator acetyltransferase complex subunit 3
Synonyms: 2610507P14Rik, KAT9
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 74195
VEGA: 14
Homologene: 7105
Recql4
Name: RecQ protein-like 4
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 79456
VEGA: 15
HGNC: HGNC:9949
Homologene: 3144
Ccdc93
Name: coiled-coil domain containing 93
Synonyms: 9230102M16Rik, 4633402D15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70829
Homologene: 10393
R3hdm2
Name: R3H domain containing 2
Synonyms: 1300003K24Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71750
Homologene: 8954
Dmac2
Name: distal membrane arm assembly complex 2
Synonyms: C030044E10Rik, 2310004L02Rik, Atp5sl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66349
Homologene: 9973
Ctr9
Name: CTR9 homolog, Paf1/RNA polymerase II complex component
Synonyms: Tsp, Tsbp, Sh2bp1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22083
Homologene: 40668
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to T, chromosome 1 at 79,435,783 bp
  • A to G, chromosome 1 at 121,497,055 bp
  • T to C, chromosome 2 at 82,985,478 bp
  • CAAGAAAACTGAAAATCAAAGAAAACTGAAAATCA to CAAGAAAACTGAAAATCA, chromosome 2 at 98,667,016 bp
  • A to C, chromosome 2 at 104,066,701 bp
  • C to T, chromosome 2 at 158,636,684 bp
  • T to A, chromosome 3 at 10,182,504 bp
  • A to T, chromosome 3 at 58,460,017 bp
  • A to G, chromosome 4 at 43,452,628 bp
  • A to T, chromosome 4 at 43,770,793 bp
  • C to T, chromosome 4 at 96,339,168 bp
  • T to C, chromosome 4 at 119,492,410 bp
  • T to C, chromosome 4 at 134,074,243 bp
  • T to A, chromosome 4 at 139,410,183 bp
  • T to C, chromosome 4 at 145,069,173 bp
  • C to T, chromosome 4 at 152,307,467 bp
  • G to A, chromosome 5 at 35,679,258 bp
  • T to C, chromosome 6 at 17,281,997 bp
  • A to G, chromosome 6 at 128,784,185 bp
  • T to C, chromosome 7 at 11,612,361 bp
  • T to C, chromosome 7 at 18,482,569 bp
  • T to A, chromosome 7 at 25,621,070 bp
  • T to A, chromosome 7 at 26,307,681 bp
  • A to G, chromosome 7 at 111,043,726 bp
  • A to G, chromosome 7 at 127,305,249 bp
  • T to A, chromosome 7 at 141,256,668 bp
  • T to A, chromosome 8 at 17,216,706 bp
  • T to C, chromosome 8 at 72,100,291 bp
  • CT to C, chromosome 8 at 104,182,032 bp
  • A to G, chromosome 9 at 9,673,287 bp
  • A to G, chromosome 9 at 18,410,313 bp
  • A to T, chromosome 10 at 52,123,232 bp
  • T to C, chromosome 10 at 58,223,604 bp
  • T to G, chromosome 10 at 127,457,652 bp
  • T to C, chromosome 10 at 128,765,204 bp
  • T to A, chromosome 12 at 49,385,360 bp
  • G to A, chromosome 13 at 33,833,230 bp
  • A to G, chromosome 13 at 74,038,248 bp
  • G to A, chromosome 14 at 65,565,421 bp
  • T to C, chromosome 15 at 76,704,346 bp
  • C to T, chromosome 15 at 89,474,057 bp
  • C to A, chromosome 15 at 99,739,670 bp
  • T to C, chromosome 15 at 102,938,297 bp
  • T to C, chromosome 16 at 8,843,001 bp
  • T to C, chromosome 16 at 59,554,996 bp
  • T to C, chromosome 17 at 32,491,874 bp
  • G to A, chromosome 19 at 4,288,483 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8789 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068608-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.