Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8801Btlr/Mmmh
Stock Number:
068611-MU
Citation ID:
RRID:MMRRC_068611-MU
Other Names:
R8801 (G1)
Major Collection:

Strain Information

Fga
Name: fibrinogen alpha chain
Synonyms: Fib, ENSMUSG00000059807
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14161
HGNC: HGNC:3661
Homologene: 428
Adamts20
Name: ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms: ADAMTS-20, bt
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223838
Homologene: 11808
Setd5
Name: SET domain containing 5
Synonyms: 2900045N06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72895
Homologene: 12485
Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Lyst
Name: lysosomal trafficking regulator
Synonyms: D13Sfk13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17101
VEGA: 13
HGNC: HGNC:1968
Homologene: 61
Oxtr
Name: oxytocin receptor
Synonyms: OTR
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18430
HGNC: HGNC:8529
Homologene: 20255
B3gnt2
Name: UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 2
Synonyms: B3Galt6, B3gnt1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53625
Homologene: 4797
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 90,942,887 bp
  • A to G, chromosome 1 at 133,905,081 bp
  • A to T, chromosome 2 at 35,902,973 bp
  • A to G, chromosome 2 at 86,553,383 bp
  • T to A, chromosome 2 at 146,223,426 bp
  • T to C, chromosome 2 at 155,564,766 bp
  • G to A, chromosome 2 at 157,233,166 bp
  • G to A, chromosome 3 at 83,030,881 bp
  • A to C, chromosome 3 at 87,997,275 bp
  • CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC to CTCCGCCGGGAGCAAGAGCTCCGCCGGGAGCAAGAGTTCCGCCGGGAGCAAGAGCTCCGCC, chromosome 3 at 93,446,708 bp
  • A to G, chromosome 4 at 98,934,611 bp
  • A to G, chromosome 4 at 128,563,402 bp
  • A to G, chromosome 4 at 144,332,868 bp
  • T to A, chromosome 5 at 21,950,856 bp
  • T to A, chromosome 6 at 42,686,808 bp
  • G to T, chromosome 6 at 83,048,648 bp
  • T to A, chromosome 6 at 85,484,681 bp
  • G to A, chromosome 6 at 92,831,991 bp
  • T to A, chromosome 6 at 112,489,912 bp
  • T to A, chromosome 6 at 113,150,892 bp
  • C to T, chromosome 6 at 122,271,383 bp
  • T to C, chromosome 6 at 145,864,613 bp
  • A to G, chromosome 7 at 45,142,014 bp
  • CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT to CTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAACAGCAGGGCTTGCAACAGCTGGACTGGCAGCAGCAGGGCTTGCAGCAGCT, chromosome 7 at 142,273,816 bp
  • C to T, chromosome 8 at 104,640,967 bp
  • T to C, chromosome 9 at 82,876,252 bp
  • A to T, chromosome 9 at 123,582,319 bp
  • A to G, chromosome 10 at 4,966,270 bp
  • T to C, chromosome 10 at 5,358,335 bp
  • C to T, chromosome 10 at 34,547,406 bp
  • T to C, chromosome 11 at 22,837,002 bp
  • T to C, chromosome 11 at 101,093,791 bp
  • G to A, chromosome 11 at 106,282,792 bp
  • T to C, chromosome 12 at 32,838,374 bp
  • A to T, chromosome 12 at 103,457,039 bp
  • A to T, chromosome 12 at 104,219,478 bp
  • T to A, chromosome 13 at 13,661,010 bp
  • T to C, chromosome 13 at 18,814,233 bp
  • T to C, chromosome 13 at 38,197,526 bp
  • A to G, chromosome 14 at 55,771,995 bp
  • T to G, chromosome 14 at 100,022,736 bp
  • G to A, chromosome 15 at 13,044,761 bp
  • T to A, chromosome 15 at 48,457,628 bp
  • T to G, chromosome 15 at 94,360,609 bp
  • A to G, chromosome 16 at 18,280,636 bp
  • C to A, chromosome 17 at 5,336,828 bp
  • A to G, chromosome 17 at 90,701,965 bp
  • T to C, chromosome 18 at 10,070,260 bp
  • A to G, chromosome 18 at 20,276,965 bp
  • T to G, chromosome 18 at 24,508,223 bp
  • T to C, chromosome 18 at 58,153,949 bp
  • A to G, chromosome 18 at 65,155,275 bp
  • T to C, chromosome 18 at 84,739,492 bp
  • G to T, chromosome 19 at 34,251,807 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8801 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068611-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.