Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8792Btlr/Mmmh
Stock Number:
068635-MU
Citation ID:
RRID:MMRRC_068635-MU
Other Names:
R8792 (G1)
Major Collection:

Strain Information

Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Aco2
Name: aconitase 2, mitochondrial
Synonyms: Aco3, Aco-2, D10Wsu183e, Irp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11429
HGNC: HGNC:118
Homologene: 856
Mnx1
Name: motor neuron and pancreas homeobox 1
Synonyms: HB9, MNR2, Hlxb9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15285
HGNC: HGNC:4979
Homologene: 21137
Mark2
Name: MAP/microtubule affinity regulating kinase 2
Synonyms: Par-1, Emk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13728
HGNC: HGNC:3332
Homologene: 69013
Asxl2
Name: ASXL transcriptional regulator 2
Synonyms: 4930556B16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75302
Homologene: 10102
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Tbc1d5
Name: TBC1 domain family, member 5
Synonyms: 1600014N05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 72238
VEGA: 17
Homologene: 8834
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Lrp6
Name: low density lipoprotein receptor-related protein 6
Synonyms: skam26Jus, Cd, ska26, skax26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16974
HGNC: HGNC:6698
Homologene: 1747
Tmprss6
Name: transmembrane serine protease 6
Synonyms: matriptase-2, 1300008A22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 71753
VEGA: 15
Homologene: 12408
Slc25a16
Name: solute carrier family 25 (mitochondrial carrier, Graves disease autoantigen), member 16
Synonyms: HGT.1, ML7, 3110021G18Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73132
Homologene: 21858
Clock
Name: clock circadian regulator
Synonyms: 5330400M04Rik, KAT13D, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Fam171b
Name: family with sequence similarity 171, member B
Synonyms: D430039N05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241520
Homologene: 18462
Eps15
Name: epidermal growth factor receptor pathway substrate 15
Synonyms: 2410112D09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13858
HGNC: HGNC:3419
Homologene: 128359
Slc12a4
Name: solute carrier family 12, member 4
Synonyms: KCC1, K-Cl Co-transporter-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20498
Homologene: 21056
Olfml2b
Name: olfactomedin-like 2B
Synonyms: 1110018N05Rik, 4832415H08Rik, photomedin-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320078
Homologene: 18546
Nkx2-2
Name: NK2 homeobox 2
Synonyms: tinman, Nkx-2.2, Nkx2.2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18088
HGNC: HGNC:7835
Homologene: 1879
Mlph
Name: melanophilin
Synonyms: Slac-2a, D1Wsu84e
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171531
Homologene: 11465
Nlrp1b
Name: NLR family, pyrin domain containing 1B
Synonyms: Nalp1b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 637515
Homologene: 19080
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Dnah14
Name: dynein, axonemal, heavy chain 14
Synonyms: LOC381311, A230079K17Rik, Gm980, Dnahc14
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240960
HGNC: HGNC:2945
Homologene: 90078
Man2b1
Name: mannosidase 2, alpha B1
Synonyms: lysosomal alpha-mannosidase
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17159
HGNC: HGNC:6826
Homologene: 37322
Serpinb6e
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6e
Synonyms: ovalbumin, SPI3B, Gm11396
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 435350
HGNC: HGNC:8950
Homologene: 50933
Strc
Name: stereocilin
Synonyms: DFNB16
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140476
Homologene: 15401
Pabpc6
Name: poly(A) binding protein, cytoplasmic 6
Synonyms: 4932702K14Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67543
VEGA: 17
Homologene: 129776
Got1l1
Name: glutamic-oxaloacetic transaminase 1-like 1
Synonyms: 1700083M11Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76615
Homologene: 65045
Lrp4
Name: low density lipoprotein receptor-related protein 4
Synonyms: 6430526J12Rik, Megf7, mdig
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228357
HGNC: HGNC:6696
Homologene: 17964
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Cblif
Name: cobalamin binding intrinsic factor
Synonyms: Gif
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14603
HGNC: HGNC:4268
Homologene: 3773
Atosb
Name: atos homolog B
Synonyms: B230312A22Rik, Fam214b
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230088
Homologene: 32625
Pld4
Name: phospholipase D family member 4
Synonyms: thss
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104759
VEGA: 12
Homologene: 16350
Gpr158
Name: G protein-coupled receptor 158
Synonyms: 5330427M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241263
Homologene: 19381
Zxdc
Name: ZXD family zinc finger C
Synonyms: B930086F11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 80292
Homologene: 82340
Adam39
Name: a disintegrin and metallopeptidase domain 39
Synonyms: 1700056P18Rik, testase 9
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546055
HGNC: HGNC:199
Homologene: 128364
Rida
Name: reactive intermediate imine deaminase A homolog
Synonyms: HRP12, HR12, Hrsp12
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15473
Homologene: 4261
Nwd2
Name: NACHT and WD repeat domain containing 2
Synonyms: B830017A01Rik, 3110047P20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319807
Homologene: 14974
I830077J02Rik
Name: RIKEN cDNA I830077J02 gene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 433638
Homologene: 45482
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Pcdhb14
Name: protocadherin beta 14
Synonyms: Pcdhb17, PcdhbN, 2210006M07Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93885
Homologene: 70876
Usp43
Name: ubiquitin specific peptidase 43
Synonyms: C630032K07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216835
Homologene: 129879
Adam6b
Name: a disintegrin and metallopeptidase domain 6B
Synonyms: 4930523C11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238405
Homologene: 128362
Phf2
Name: PHD finger protein 2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18676
VEGA: 13
HGNC: HGNC:8920
Homologene: 3934
Cdk9
Name: cyclin dependent kinase 9
Synonyms: PITALRE
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 107951
HGNC: HGNC:1780
Homologene: 55566
Zfyve16
Name: zinc finger, FYVE domain containing 16
Synonyms: B130024H06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218441
Homologene: 8826
Pde8b
Name: phosphodiesterase 8B
Synonyms: B230331L10Rik, C030047E14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218461
HGNC: HGNC:8794
Homologene: 2758
Pgap4
Name: post-GPI attachment to proteins GalNAc transferase 4
Synonyms: 9330170P15Rik, 2810432L12Rik, Tmem246
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67063
Homologene: 12080
Hoxc9
Name: homeobox C9
Synonyms: Hox-3.2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 15427
HGNC: HGNC:5130
Homologene: 130558
Gal3st4
Name: galactose-3-O-sulfotransferase 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330217
Homologene: 11633
Tll1
Name: tolloid-like
Synonyms: Tll-1, b2b2476Clo
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 21892
Homologene: 49202
Parp12
Name: poly (ADP-ribose) polymerase family, member 12
Synonyms: Zc3hdc1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243771
Homologene: 11236
Rnf19b
Name: ring finger protein 19B
Synonyms: 4930534K13Rik, 4930555L03Rik, Ibrdc3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 75234
Homologene: 34999
Or4f14b
Name: olfactory receptor family 4 subfamily F member 14B
Synonyms: GA_x6K02T2Q125-72988111-72987173, MOR245-19P, Olfr1307
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257956
Homologene: 128383
Gpr146
Name: G protein-coupled receptor 146
Synonyms: PGR8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 80290
Homologene: 36472
Garin2
Name: golgi associated RAB2 interactor 2
Synonyms: 4930516C23Rik, 4921509E07Rik, Fam71d
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70897
Homologene: 49887
Ift70a1
Name: intraflagellar transport 70A1
Synonyms: 4930506L13Rik, Ttc30a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78802
Homologene: 136638
Or4c121
Name: olfactory receptor family 4 subfamily C member 121
Synonyms: GA_x6K02T2Q125-50672630-50671698, MOR233-2, Olfr1226
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258969
Homologene: 27315
Rpl3l
Name: ribosomal protein L3-like
Synonyms: 1110057H16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 66211
Homologene: 68434
Or1e27
Name: olfactory receptor family 1 subfamily E member 27
Synonyms: GA_x6K02T2P1NL-3823071-3824002, MOR135-17, Or1e27-ps1, Olfr387-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258210
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 4,024,868 bp
  • T to C, chromosome 1 at 90,942,960 bp
  • A to T, chromosome 1 at 170,681,100 bp
  • A to T, chromosome 1 at 181,814,624 bp
  • G to A, chromosome 2 at 21,553,326 bp
  • A to T, chromosome 2 at 32,708,257 bp
  • C to A, chromosome 2 at 75,981,554 bp
  • T to A, chromosome 2 at 83,812,759 bp
  • T to C, chromosome 2 at 89,193,887 bp
  • C to T, chromosome 2 at 91,494,955 bp
  • G to C, chromosome 2 at 111,944,728 bp
  • A to G, chromosome 2 at 118,546,905 bp
  • T to A, chromosome 2 at 121,377,805 bp
  • A to T, chromosome 2 at 147,177,893 bp
  • T to C, chromosome 3 at 105,927,788 bp
  • G to A, chromosome 4 at 43,033,546 bp
  • T to C, chromosome 4 at 49,587,067 bp
  • T to C, chromosome 4 at 109,305,711 bp
  • T to A, chromosome 4 at 129,058,685 bp
  • G to A, chromosome 5 at 29,478,374 bp
  • T to C, chromosome 5 at 63,805,704 bp
  • T to A, chromosome 5 at 76,262,727 bp
  • A to G, chromosome 5 at 81,688,675 bp
  • C to T, chromosome 5 at 138,270,989 bp
  • A to G, chromosome 5 at 139,392,794 bp
  • A to G, chromosome 6 at 39,089,050 bp
  • A to G, chromosome 6 at 90,370,004 bp
  • T to C, chromosome 6 at 134,486,586 bp
  • C to A, chromosome 8 at 27,200,721 bp
  • G to T, chromosome 8 at 40,826,576 bp
  • T to A, chromosome 8 at 64,085,465 bp
  • C to T, chromosome 8 at 85,095,144 bp
  • G to A, chromosome 8 at 105,946,758 bp
  • A to G, chromosome 8 at 124,674,360 bp
  • C to A, chromosome 9 at 66,465,486 bp
  • T to G, chromosome 10 at 39,048,052 bp
  • C to T, chromosome 10 at 62,928,340 bp
  • T to A, chromosome 11 at 67,876,418 bp
  • T to C, chromosome 11 at 71,160,093 bp
  • T to C, chromosome 11 at 73,664,645 bp
  • T to C, chromosome 11 at 116,456,630 bp
  • T to C, chromosome 12 at 3,496,536 bp
  • C to T, chromosome 12 at 78,715,150 bp
  • T to C, chromosome 12 at 112,763,490 bp
  • T to C, chromosome 12 at 113,491,690 bp
  • A to T, chromosome 13 at 33,838,959 bp
  • C to T, chromosome 13 at 48,817,505 bp
  • A to T, chromosome 13 at 89,692,111 bp
  • T to C, chromosome 13 at 92,523,161 bp
  • T to A, chromosome 13 at 95,043,026 bp
  • T to A, chromosome 13 at 98,815,261 bp
  • C to T, chromosome 15 at 34,495,096 bp
  • T to A, chromosome 15 at 78,444,128 bp
  • T to C, chromosome 15 at 81,909,496 bp
  • C to A, chromosome 15 at 84,328,959 bp
  • A to G, chromosome 15 at 102,981,794 bp
  • T to C, chromosome 17 at 9,669,403 bp
  • A to G, chromosome 17 at 24,728,473 bp
  • TTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTG, chromosome 17 at 50,799,934 bp
  • T to C, chromosome 18 at 37,449,488 bp
  • G to T, chromosome 19 at 7,281,215 bp
  • C to A, chromosome 19 at 11,750,235 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8792 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068635-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.