Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8792Btlr/Mmmh
Stock Number:
068635-MU
Citation ID:
RRID:MMRRC_068635-MU
Other Names:
R8792 (G1)
Major Collection:

Strain Information

Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Aco2
Name: aconitase 2, mitochondrial
Synonyms: Aco3, Aco-2, D10Wsu183e, Irp1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11429
HGNC: HGNC:118
Homologene: 856
Mnx1
Name: motor neuron and pancreas homeobox 1
Synonyms: HB9, MNR2, Hlxb9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 15285
HGNC: HGNC:4979
Homologene: 21137
Mark2
Name: MAP/microtubule affinity regulating kinase 2
Synonyms: Par-1, Emk
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13728
HGNC: HGNC:3332
Homologene: 69013
Asxl2
Name: ASXL transcriptional regulator 2
Synonyms: 4930556B16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75302
Homologene: 10102
Fcho2
Name: FCH domain only 2
Synonyms: 5832424M12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218503
VEGA: 13
Homologene: 9030
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 4,024,868 bp
  • T to C, chromosome 1 at 90,942,960 bp
  • A to T, chromosome 1 at 170,681,100 bp
  • A to T, chromosome 1 at 181,814,624 bp
  • G to A, chromosome 2 at 21,553,326 bp
  • A to T, chromosome 2 at 32,708,257 bp
  • C to A, chromosome 2 at 75,981,554 bp
  • T to A, chromosome 2 at 83,812,759 bp
  • T to C, chromosome 2 at 89,193,887 bp
  • C to T, chromosome 2 at 91,494,955 bp
  • G to C, chromosome 2 at 111,944,728 bp
  • A to G, chromosome 2 at 118,546,905 bp
  • T to A, chromosome 2 at 121,377,805 bp
  • A to T, chromosome 2 at 147,177,893 bp
  • T to C, chromosome 3 at 105,927,788 bp
  • G to A, chromosome 4 at 43,033,546 bp
  • T to C, chromosome 4 at 49,587,067 bp
  • T to C, chromosome 4 at 109,305,711 bp
  • T to A, chromosome 4 at 129,058,685 bp
  • G to A, chromosome 5 at 29,478,374 bp
  • T to C, chromosome 5 at 63,805,704 bp
  • T to A, chromosome 5 at 76,262,727 bp
  • A to G, chromosome 5 at 81,688,675 bp
  • C to T, chromosome 5 at 138,270,989 bp
  • A to G, chromosome 5 at 139,392,794 bp
  • A to G, chromosome 6 at 39,089,050 bp
  • A to G, chromosome 6 at 90,370,004 bp
  • T to C, chromosome 6 at 134,486,586 bp
  • C to A, chromosome 8 at 27,200,721 bp
  • G to T, chromosome 8 at 40,826,576 bp
  • T to A, chromosome 8 at 64,085,465 bp
  • C to T, chromosome 8 at 85,095,144 bp
  • G to A, chromosome 8 at 105,946,758 bp
  • A to G, chromosome 8 at 124,674,360 bp
  • C to A, chromosome 9 at 66,465,486 bp
  • T to G, chromosome 10 at 39,048,052 bp
  • C to T, chromosome 10 at 62,928,340 bp
  • T to A, chromosome 11 at 67,876,418 bp
  • T to C, chromosome 11 at 71,160,093 bp
  • T to C, chromosome 11 at 73,664,645 bp
  • T to C, chromosome 11 at 116,456,630 bp
  • T to C, chromosome 12 at 3,496,536 bp
  • C to T, chromosome 12 at 78,715,150 bp
  • T to C, chromosome 12 at 112,763,490 bp
  • T to C, chromosome 12 at 113,491,690 bp
  • A to T, chromosome 13 at 33,838,959 bp
  • C to T, chromosome 13 at 48,817,505 bp
  • A to T, chromosome 13 at 89,692,111 bp
  • T to C, chromosome 13 at 92,523,161 bp
  • T to A, chromosome 13 at 95,043,026 bp
  • T to A, chromosome 13 at 98,815,261 bp
  • C to T, chromosome 15 at 34,495,096 bp
  • T to A, chromosome 15 at 78,444,128 bp
  • T to C, chromosome 15 at 81,909,496 bp
  • C to A, chromosome 15 at 84,328,959 bp
  • A to G, chromosome 15 at 102,981,794 bp
  • T to C, chromosome 17 at 9,669,403 bp
  • A to G, chromosome 17 at 24,728,473 bp
  • TTGCTGCTGCTGCTGCTG to TTGCTGCTGCTGCTGCTGCTG, chromosome 17 at 50,799,934 bp
  • T to C, chromosome 18 at 37,449,488 bp
  • G to T, chromosome 19 at 7,281,215 bp
  • C to A, chromosome 19 at 11,750,235 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8792 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068635-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.