Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8871Btlr/Mmmh
Stock Number:
068685-MU
Citation ID:
RRID:MMRRC_068685-MU
Other Names:
R8871 (G1)
Major Collection:

Strain Information

S1pr1
Name: sphingosine-1-phosphate receptor 1
Synonyms: S1P1, S1P, Edg1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13609
HGNC: HGNC:3165
Homologene: 1071
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Sh3gl2
Name: SH3-domain GRB2-like 2
Synonyms: EEN-B1, endophilin I, Sh3d2a, 9530001L19Rik, B930049H17Rik, endophilin A1, EEN1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20404
Homologene: 20652
Olig1
Name: oligodendrocyte transcription factor 1
Synonyms: Olg-1, Bhlhb6, bHLHe21
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50914
Homologene: 9667
Sort1
Name: sortilin 1
Synonyms: sortilin, neurotensin receptor 3, Ntsr3, Ntr3, 2900053A11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20661
Homologene: 136097
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 16,997,495 bp
  • A to T, chromosome 1 at 24,744,354 bp
  • T to A, chromosome 1 at 40,105,264 bp
  • T to C, chromosome 1 at 40,602,855 bp
  • A to G, chromosome 1 at 54,990,349 bp
  • A to G, chromosome 2 at 29,148,102 bp
  • T to C, chromosome 2 at 37,005,048 bp
  • T to C, chromosome 2 at 86,423,353 bp
  • A to G, chromosome 2 at 91,010,495 bp
  • A to G, chromosome 2 at 148,754,634 bp
  • A to G, chromosome 2 at 150,118,075 bp
  • T to C, chromosome 2 at 152,322,176 bp
  • T to C, chromosome 3 at 89,852,488 bp
  • G to A, chromosome 3 at 108,355,571 bp
  • A to G, chromosome 3 at 115,711,979 bp
  • T to G, chromosome 4 at 47,108,582 bp
  • C to A, chromosome 4 at 85,387,580 bp
  • ACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT to ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT, chromosome 4 at 87,841,315 bp
  • T to A, chromosome 4 at 126,058,742 bp
  • T to A, chromosome 5 at 26,117,865 bp
  • A to T, chromosome 5 at 43,699,943 bp
  • A to G, chromosome 5 at 92,017,130 bp
  • T to A, chromosome 5 at 96,707,398 bp
  • A to G, chromosome 5 at 108,999,033 bp
  • A to G, chromosome 5 at 114,630,450 bp
  • T to C, chromosome 5 at 115,330,653 bp
  • A to G, chromosome 5 at 144,821,839 bp
  • A to T, chromosome 6 at 66,716,458 bp
  • A to T, chromosome 6 at 91,256,233 bp
  • A to G, chromosome 6 at 100,783,148 bp
  • T to G, chromosome 6 at 117,923,850 bp
  • T to A, chromosome 7 at 17,760,902 bp
  • A to T, chromosome 7 at 24,384,075 bp
  • G to T, chromosome 7 at 25,081,137 bp
  • T to A, chromosome 7 at 32,101,119 bp
  • T to A, chromosome 7 at 128,136,051 bp
  • T to C, chromosome 7 at 131,116,868 bp
  • G to A, chromosome 8 at 33,576,964 bp
  • A to T, chromosome 8 at 37,952,949 bp
  • A to C, chromosome 8 at 40,795,564 bp
  • A to T, chromosome 8 at 71,479,300 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • A to G, chromosome 8 at 108,950,235 bp
  • C to A, chromosome 9 at 18,656,048 bp
  • A to T, chromosome 9 at 39,589,702 bp
  • A to T, chromosome 9 at 45,338,406 bp
  • C to T, chromosome 9 at 50,683,796 bp
  • C to A, chromosome 9 at 62,761,541 bp
  • T to C, chromosome 9 at 75,278,303 bp
  • T to G, chromosome 9 at 86,755,191 bp
  • G to A, chromosome 9 at 108,449,672 bp
  • T to A, chromosome 11 at 8,950,503 bp
  • T to G, chromosome 11 at 9,298,071 bp
  • A to G, chromosome 11 at 60,200,769 bp
  • A to T, chromosome 11 at 75,453,093 bp
  • A to G, chromosome 11 at 102,192,070 bp
  • T to C, chromosome 11 at 103,456,549 bp
  • T to A, chromosome 11 at 119,603,925 bp
  • T to C, chromosome 12 at 40,745,731 bp
  • A to T, chromosome 12 at 98,246,284 bp
  • T to C, chromosome 13 at 46,830,803 bp
  • T to A, chromosome 13 at 58,409,342 bp
  • A to C, chromosome 13 at 100,049,667 bp
  • G to A, chromosome 13 at 100,443,638 bp
  • A to T, chromosome 14 at 55,520,727 bp
  • A to G, chromosome 14 at 65,293,899 bp
  • G to A, chromosome 15 at 4,035,281 bp
  • T to G, chromosome 15 at 55,382,562 bp
  • T to A, chromosome 15 at 79,525,843 bp
  • G to A, chromosome 15 at 84,179,308 bp
  • T to C, chromosome 16 at 3,964,104 bp
  • T to C, chromosome 16 at 19,530,786 bp
  • T to C, chromosome 16 at 20,605,934 bp
  • T to C, chromosome 16 at 59,558,156 bp
  • T to C, chromosome 16 at 91,270,657 bp
  • A to T, chromosome 17 at 22,145,714 bp
  • C to A, chromosome 17 at 23,666,803 bp
  • G to A, chromosome 17 at 33,935,000 bp
  • T to C, chromosome 17 at 34,978,823 bp
  • A to G, chromosome 17 at 58,888,038 bp
  • C to T, chromosome 17 at 84,682,867 bp
  • T to A, chromosome 19 at 16,663,822 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8871 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068685-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.