Strain Name:
C57BL/6J-MtgxR8871Btlr/Mmmh
Stock Number:
068685-MU
Citation ID:
RRID:MMRRC_068685-MU
Other Names:
R8871 (G1)
Major Collection:

Strain Information

S1pr1
Name: sphingosine-1-phosphate receptor 1
Synonyms: S1P1, S1P, Edg1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13609
HGNC: HGNC:3165
Homologene: 1071
Rptor
Name: regulatory associated protein of MTOR, complex 1
Synonyms: raptor, 4932417H02Rik, Rap
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74370
Homologene: 80210
Sh3gl2
Name: SH3-domain GRB2-like 2
Synonyms: EEN-B1, endophilin I, Sh3d2a, 9530001L19Rik, B930049H17Rik, endophilin A1, EEN1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 20404
Homologene: 20652
Olig1
Name: oligodendrocyte transcription factor 1
Synonyms: Olg-1, Bhlhb6, bHLHe21
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 50914
Homologene: 9667
Sort1
Name: sortilin 1
Synonyms: sortilin, neurotensin receptor 3, Ntsr3, Ntr3, 2900053A11Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20661
Homologene: 136097
Crybg3
Name: beta-gamma crystallin domain containing 3
Synonyms: Gm9581
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224273
Homologene: 28544
Setx
Name: senataxin
Synonyms: A930037J23Rik, Als4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269254
HGNC: HGNC:445
Homologene: 41003
Zfhx3
Name: zinc finger homeobox 3
Synonyms: WBP9, A230102L03Rik, Atbf1, Sci
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11906
HGNC: HGNC:777
Homologene: 21366
Celf1
Name: CUGBP, Elav-like family member 1
Synonyms: CUG-BP, Brunol2, D2Wsu101e, 1600010O03Rik, CUG-BP1, Cugbp1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13046
HGNC: HGNC:2549
Homologene: 134102
Sf3b1
Name: splicing factor 3b, subunit 1
Synonyms: SAP155, Prp10, SF3b155, 2810001M05Rik, Targ4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 81898
Homologene: 6696
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Dock4
Name: dedicator of cytokinesis 4
Synonyms: EST N28122, 6330411N01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238130
VEGA: 12
Homologene: 56680
Hnrnpf
Name: heterogeneous nuclear ribonucleoprotein F
Synonyms: 4833420I20Rik, Hnrpf
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 98758
HGNC: HGNC:5039
Homologene: 21032
Abcg5
Name: ATP binding cassette subfamily G member 5
Synonyms: Sterolin-1, trac, cmp
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 27409
Homologene: 31909
Bdp1
Name: B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB
Synonyms: TFIIIB150, TFIIIB90, TAF3B1, TFC5, Tfnr, G630013P12Rik, B130055N23Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544971
Homologene: 34582
Cc2d2a
Name: coiled-coil and C2 domain containing 2A
Synonyms: 5730509K17Rik, b2b1035Clo
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231214
Homologene: 18159
Rbck1
Name: RanBP-type and C3HC4-type zinc finger containing 1
Synonyms: Ubce7ip3, HOIL-1L, HOIL-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24105
Homologene: 32448
Mllt3
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 3
Synonyms: 3830408D16Rik, D4Ertd321e, Af9, 2210011H10Rik, 2610012I03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 70122
HGNC: HGNC:7136
Homologene: 37933
Dmbt1
Name: deleted in malignant brain tumors 1
Synonyms: CRP-[b], CRP-[a], ebnerin, hensin, vomeroglandin, Crpd, MUCLIN, gp300
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12945
HGNC: HGNC:2926
Homologene: 68990
Pnpla3
Name: patatin-like phospholipase domain containing 3
Synonyms: Adpn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 116939
VEGA: 15
Homologene: 11883
Trpv4
Name: transient receptor potential cation channel, subfamily V, member 4
Synonyms: VR-OAC, Trp12, 0610033B08Rik, OTRPC4, VROAC, VRL-2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 63873
Homologene: 11003
Muc16
Name: mucin 16
Synonyms: LOC385009, 1110008I14Rik, Gm21044
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Srebf1
Name: sterol regulatory element binding transcription factor 1
Synonyms: SREBP-1, ADD-1, SREBP-1c, SREBP-1a, SREBP1, SREBP1c, bHLHd1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20787
Homologene: 3079
Kif13a
Name: kinesin family member 13A
Synonyms: N-3 kinesin, 4930505I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16553
VEGA: 13
Homologene: 22589
Lmbrd1
Name: LMBR1 domain containing 1
Synonyms: 0910001K20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68421
Homologene: 10156
Zfp574
Name: zinc finger protein 574
Synonyms: A630056B21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232976
Homologene: 11238
Vps13a
Name: vacuolar protein sorting 13A
Synonyms: 4930516E05Rik, D330038K10Rik, 4930543C13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 271564
VEGA: 19
HGNC: HGNC:1908
Homologene: 22068
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Prss35
Name: serine protease 35
Synonyms: 6030424L22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244954
Homologene: 17734
Slc9a4
Name: solute carrier family 9 (sodium/hydrogen exchanger), member 4
Synonyms: NHE4, D730009J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 110895
Homologene: 72232
Galnt12
Name: polypeptide N-acetylgalactosaminyltransferase 12
Synonyms: A630062B03Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230145
Homologene: 11637
Adam20
Name: a disintegrin and metallopeptidase domain 20
Synonyms: 4930529F22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384806
HGNC: HGNC:199
Homologene: 128364
Cdkl2
Name: cyclin dependent kinase like 2
Synonyms: Kkm, KKIAMRE, 5330436L21Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 53886
HGNC: HGNC:1782
Homologene: 55793
Abca13
Name: ATP-binding cassette, sub-family A member 13
Synonyms: A930002G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268379
Homologene: 27991
Itga11
Name: integrin alpha 11
Synonyms: 4732459H24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319480
HGNC: HGNC:6136
Homologene: 8151
Tex15
Name: testis expressed gene 15 meiosis and synapsis associated
Synonyms: 2210014E14Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104271
Homologene: 12837
Lrrc37a
Name: leucine rich repeat containing 37A
Synonyms: LOC237954
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237954
Homologene: 138824
Pdzph1
Name: PDZ and pleckstrin homology domains 1
Synonyms: 2610034M16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 69239
Homologene: 130756
Kcnn4
Name: potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4
Synonyms: SK4, IK1, mIKCa1, IKCa1, KCa3.1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16534
HGNC: HGNC:6293
Homologene: 1696
Il1r2
Name: interleukin 1 receptor, type II
Synonyms: IL-1 receptor beta chain, CD121b, Il1r-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16178
HGNC: HGNC:5994
Homologene: 7783
Zfp120
Name: zinc finger protein 120
Synonyms: MZF31, E030042N05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 104348
Homologene: 138454
Vmn2r10
Name: vomeronasal 2, receptor 10
Synonyms: VR16, V2r16
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22307
Homologene: 129606
Col14a1
Name: collagen, type XIV, alpha 1
Synonyms: 5730412L22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12818
HGNC: HGNC:2191
Homologene: 18741
Gxylt2
Name: glucoside xylosyltransferase 2
Synonyms: LOC232313, Glt8d4
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232313
Homologene: 16823
Fras1
Name: Fraser extracellular matrix complex subunit 1
Synonyms: bl, E130113P14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231470
Homologene: 23516
Naip1
Name: NLR family, apoptosis inhibitory protein 1
Synonyms: D13Lsd1, Naip, Birc1a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17940
VEGA: 13
HGNC: HGNC:7634
Homologene: 113589
Nlrc3
Name: NLR family, CARD domain containing 3
Synonyms: D230007K08Rik, Caterpiller 16.2, CLR16.2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268857
Homologene: 18720
Zfp947
Name: zinc finger protein 947
Synonyms: Gm4769
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210853
Homologene: 133253
Sgcz
Name: sarcoglycan zeta
Synonyms: C230085N17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244431
Homologene: 26726
Or12k5
Name: olfactory receptor family 12 subfamily K member 5
Synonyms: GA_x6K02T2NLDC-33697309-33696317, MOR159-4, Olfr358
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227789
Homologene: 74157
Fbln2
Name: fibulin 2
Synonyms: 5730577E14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14115
HGNC: HGNC:3601
Homologene: 1514
Myo5c
Name: myosin VC
Synonyms: 9130003O20Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208943
VEGA: 9
HGNC: HGNC:7604
Homologene: 135711
Srsf9
Name: serine and arginine-rich splicing factor 9
Synonyms: SRp30c, 2610029M16Rik, Sfrs9
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 108014
Homologene: 20819
Cstl1
Name: cystatin-like 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228756
Homologene: 16283
AW551984
Name: expressed sequence AW551984
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244810
HGNC: HGNC:6658
Or8j3c
Name: olfactory receptor family 8 subfamily J member 3C
Synonyms: GA_x6K02T2Q125-47892992-47892045, MOR185-1, Olfr1062
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259082
Homologene: 83135
Galc
Name: galactosylceramidase
Synonyms: Gacy, 2310068B06Rik, galactocerebrosidase, A930008M05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14420
VEGA: 12
HGNC: HGNC:4115
Homologene: 124
Dixdc1
Name: DIX domain containing 1
Synonyms: 4930563F16Rik, Ccd1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330938
Homologene: 82369
Tmprss13
Name: transmembrane protease, serine 13
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214531
Homologene: 12936
Ano8
Name: anoctamin 8
Synonyms: Tmem16h
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382014
Homologene: 124473
Rgl2
Name: ral guanine nucleotide dissociation stimulator-like 2
Synonyms: Rlf, KE1.5, Rab2l, Rgt2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 19732
HGNC: HGNC:9769
Homologene: 3494
Hspa1l
Name: heat shock protein 1-like
Synonyms: Msh5, Hsc70t, 70kDa
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15482
HGNC: HGNC:5234
Homologene: 135835
Itgax
Name: integrin alpha X
Synonyms: CD11C (p150) alpha polypeptide, Cd11c, CR4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 16411
HGNC: HGNC:6152
Homologene: 55493
Ceacam5
Name: CEA cell adhesion molecule 5
Synonyms: 1600029H12Rik, Psg30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 73250
HGNC: HGNC:1819
Homologene: 115938
Klhdc8b
Name: kelch domain containing 8B
Synonyms: 4931406O17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78267
Homologene: 45463
Or2l13b
Name: olfactory receptor family 2 subfamily L member 13B
Synonyms: GA_x54KRFPKG5P-15979009-15978071, MOR271-1, Olfr168
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258354
Homologene: 128057
Oscp1
Name: organic solute carrier partner 1
Synonyms: 6030436A01Rik, 1810007P19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230751
Homologene: 71010
Vmn1r36
Name: vomeronasal 1 receptor 36
Synonyms: V1rc11
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171184
Homologene: 110800
Jph1
Name: junctophilin 1
Synonyms: mitsugumin72, JP-1, ENSMUSG00000054314
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 57339
Homologene: 10761
She
Name: src homology 2 domain-containing transforming protein E
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214547
Homologene: 18186
Bicdl2
Name: BICD family like cargo adaptor 2
Synonyms: Ccdc64b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 212733
VEGA: 17
Homologene: 17815
Oxct1
Name: 3-oxoacid CoA transferase 1
Synonyms: 2610008O03Rik, Scot-s
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67041
HGNC: HGNC:8527
Homologene: 377
G6pc3
Name: glucose 6 phosphatase, catalytic, 3
Synonyms: 0710001K01Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68401
Homologene: 16304
Fbxo16
Name: F-box protein 16
Synonyms: Fbx16
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50759
VEGA: 14
Homologene: 9273
Wdr81
Name: WD repeat domain 81
Synonyms: shakey 5, MGC32441, nur5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192652
Homologene: 13983
Kdelr3
Name: KDEL (Lys-Asp-Glu-Leu) endoplasmic reticulum protein retention receptor 3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105785
VEGA: 15
HGNC: HGNC:6306
Homologene: 68533
Alg3
Name: ALG3 alpha-1,3- mannosyltransferase
Synonyms: D16Ertd36e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208624
Homologene: 4228
Nrl
Name: neural retina leucine zipper gene
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 18185
VEGA: 14
HGNC: HGNC:8002
Homologene: 4501
Rmi1
Name: RecQ mediated genome instability 1
Synonyms: 4932432N11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74386
VEGA: 13
Homologene: 41601
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, CKLFH1, Cklfsf1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Gm10220
Name: predicted gene 10220
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 434689
Homologene: 69402
Scgb1b10
Name: secretoglobin, family 1B, member 10
Synonyms: Gm4384, Abpa10
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 102635992
Homologene: 114479
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 16,997,495 bp
  • A to T, chromosome 1 at 24,744,354 bp
  • T to A, chromosome 1 at 40,105,264 bp
  • T to C, chromosome 1 at 40,602,855 bp
  • A to G, chromosome 1 at 54,990,349 bp
  • A to G, chromosome 2 at 29,148,102 bp
  • T to C, chromosome 2 at 37,005,048 bp
  • T to C, chromosome 2 at 86,423,353 bp
  • A to G, chromosome 2 at 91,010,495 bp
  • A to G, chromosome 2 at 148,754,634 bp
  • A to G, chromosome 2 at 150,118,075 bp
  • T to C, chromosome 2 at 152,322,176 bp
  • T to C, chromosome 3 at 89,852,488 bp
  • G to A, chromosome 3 at 108,355,571 bp
  • A to G, chromosome 3 at 115,711,979 bp
  • T to G, chromosome 4 at 47,108,582 bp
  • C to A, chromosome 4 at 85,387,580 bp
  • ACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT to ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT, chromosome 4 at 87,841,315 bp
  • T to A, chromosome 4 at 126,058,742 bp
  • T to A, chromosome 5 at 26,117,865 bp
  • A to T, chromosome 5 at 43,699,943 bp
  • A to G, chromosome 5 at 92,017,130 bp
  • T to A, chromosome 5 at 96,707,398 bp
  • A to G, chromosome 5 at 108,999,033 bp
  • A to G, chromosome 5 at 114,630,450 bp
  • T to C, chromosome 5 at 115,330,653 bp
  • A to G, chromosome 5 at 144,821,839 bp
  • A to T, chromosome 6 at 66,716,458 bp
  • A to T, chromosome 6 at 91,256,233 bp
  • A to G, chromosome 6 at 100,783,148 bp
  • T to G, chromosome 6 at 117,923,850 bp
  • T to A, chromosome 7 at 17,760,902 bp
  • A to T, chromosome 7 at 24,384,075 bp
  • G to T, chromosome 7 at 25,081,137 bp
  • T to A, chromosome 7 at 32,101,119 bp
  • T to A, chromosome 7 at 128,136,051 bp
  • T to C, chromosome 7 at 131,116,868 bp
  • G to A, chromosome 8 at 33,576,964 bp
  • A to T, chromosome 8 at 37,952,949 bp
  • A to C, chromosome 8 at 40,795,564 bp
  • A to T, chromosome 8 at 71,479,300 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • A to G, chromosome 8 at 108,950,235 bp
  • C to A, chromosome 9 at 18,656,048 bp
  • A to T, chromosome 9 at 39,589,702 bp
  • A to T, chromosome 9 at 45,338,406 bp
  • C to T, chromosome 9 at 50,683,796 bp
  • C to A, chromosome 9 at 62,761,541 bp
  • T to C, chromosome 9 at 75,278,303 bp
  • T to G, chromosome 9 at 86,755,191 bp
  • G to A, chromosome 9 at 108,449,672 bp
  • T to A, chromosome 11 at 8,950,503 bp
  • T to G, chromosome 11 at 9,298,071 bp
  • A to G, chromosome 11 at 60,200,769 bp
  • A to T, chromosome 11 at 75,453,093 bp
  • A to G, chromosome 11 at 102,192,070 bp
  • T to C, chromosome 11 at 103,456,549 bp
  • T to A, chromosome 11 at 119,603,925 bp
  • T to C, chromosome 12 at 40,745,731 bp
  • A to T, chromosome 12 at 98,246,284 bp
  • T to C, chromosome 13 at 46,830,803 bp
  • T to A, chromosome 13 at 58,409,342 bp
  • A to C, chromosome 13 at 100,049,667 bp
  • G to A, chromosome 13 at 100,443,638 bp
  • A to T, chromosome 14 at 55,520,727 bp
  • A to G, chromosome 14 at 65,293,899 bp
  • G to A, chromosome 15 at 4,035,281 bp
  • T to G, chromosome 15 at 55,382,562 bp
  • T to A, chromosome 15 at 79,525,843 bp
  • G to A, chromosome 15 at 84,179,308 bp
  • T to C, chromosome 16 at 3,964,104 bp
  • T to C, chromosome 16 at 19,530,786 bp
  • T to C, chromosome 16 at 20,605,934 bp
  • T to C, chromosome 16 at 59,558,156 bp
  • T to C, chromosome 16 at 91,270,657 bp
  • A to T, chromosome 17 at 22,145,714 bp
  • C to A, chromosome 17 at 23,666,803 bp
  • G to A, chromosome 17 at 33,935,000 bp
  • T to C, chromosome 17 at 34,978,823 bp
  • A to G, chromosome 17 at 58,888,038 bp
  • C to T, chromosome 17 at 84,682,867 bp
  • T to A, chromosome 19 at 16,663,822 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8871 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068685-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.