Strain Name:
C57BL/6J-MtgxR8892Btlr/Mmmh
Stock Number:
068695-MU
Citation ID:
RRID:MMRRC_068695-MU
Other Names:
R8892 (G1)
Major Collection:

Strain Information

Pou2f1
Name: POU domain, class 2, transcription factor 1
Synonyms: Oct-1C, Oct-1B, Oct-1A, oct-1, Otf-1, Otf1, 2810482H01Rik, Oct-1z, Oct1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18986
HGNC: HGNC:9212
Homologene: 37658
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, non-erythrocytic, 9930031C03Rik, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Krt5
Name: keratin 5
Synonyms: 3300001P10Rik, Tfip8, K5, Krt2-5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110308
HGNC: HGNC:6442
Homologene: 55461
Tlr9
Name: toll-like receptor 9
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81897
Homologene: 68126
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Ctnna1
Name: catenin alpha 1
Synonyms: alpha(E)-catenin, alpha E catenin, Catna1, 2010010M04Rik, catenin (cadherin associated protein), alpha 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12385
VEGA: 18
HGNC: HGNC:2509
Homologene: 1433
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Ppp2r3c
Name: protein phosphatase 2, regulatory subunit B'', gamma
Synonyms: 5730412A08Rik, G4-1, G5pr, 4930511A21Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 59032
VEGA: 12
Homologene: 9915
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Mgll
Name: monoglyceride lipase
Synonyms: Magl
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 23945
Homologene: 38298
Ltn1
Name: listerin E3 ubiquitin protein ligase 1
Synonyms: 4930528H02Rik, Zfp294, Listerin, Rnf160
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 78913
VEGA: 16
Homologene: 32272
Xrcc5
Name: X-ray repair complementing defective repair in Chinese hamster cells 5
Synonyms: Ku80, Ku86
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22596
VEGA: 1
Homologene: 40681
Clasp2
Name: CLIP associating protein 2
Synonyms: 1500004F14Rik, CLASP2gamma, CLASP2beta, CLASP2alpha, CLASP2, 8030404L10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76499
VEGA: 9
Homologene: 24944
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Ap3b1
Name: adaptor-related protein complex 3, beta 1 subunit
Synonyms: rim2, Hps2, recombination induced mutation 2, beta3A, AP-3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 11774
VEGA: 13
HGNC: HGNC:566
Homologene: 68125
Tango6
Name: transport and golgi organization 6
Synonyms: Tmco7, Tango6
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 272538
Homologene: 52121
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Cacnb1
Name: calcium channel, voltage-dependent, beta 1 subunit
Synonyms: Cchlb1, Cchb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12295
HGNC: HGNC:1401
Homologene: 20186
Epha8
Name: Eph receptor A8
Synonyms: EphA8, Hek3, Eek
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Naa16
Name: N(alpha)-acetyltransferase 16, NatA auxiliary subunit
Synonyms: 1300019C06Rik, Narg1l
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66897
Homologene: 134838
Spc24
Name: SPC24, NDC80 kinetochore complex component, homolog (S. cerevisiae)
Synonyms: 2410030K01Rik, Spbc24
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67629
VEGA: 9
Homologene: 12166
Cramp1
Name: cramped chromatin regulator 1
Synonyms: 5830477H08Rik, Tce4, Cramp1l
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 57354
VEGA: 17
Homologene: 35373
Ipo9
Name: importin 9
Synonyms: 0710008K06Rik, Imp9
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226432
Homologene: 5874
Lhx4
Name: LIM homeobox protein 4
Synonyms: Gsh-4, Gsh4, A330062J17Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16872
Homologene: 56497
Mmp16
Name: matrix metallopeptidase 16
Synonyms: Membrane type 3-MMP, MT3-MMP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17389
HGNC: HGNC:7162
Homologene: 55939
Zdhhc6
Name: zinc finger, DHHC domain containing 6
Synonyms: 5930409M18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66980
VEGA: 19
Homologene: 41487
Vps50
Name: VPS50 EARP/GARPII complex subunit
Synonyms: 8430415E05Rik, 1700034M03Rik, Ccdc132
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73288
Homologene: 11498
Camkv
Name: CaM kinase-like vesicle-associated
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235604
Homologene: 56983
Magi3
Name: membrane associated guanylate kinase, WW and PDZ domain containing 3
Synonyms: 4732496O19Rik, 6530407C02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99470
Homologene: 26431
Slc39a6
Name: solute carrier family 39 (metal ion transporter), member 6
Synonyms: Ermelin, Zip6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 106957
Homologene: 8199
Ahcyl1
Name: S-adenosylhomocysteine hydrolase-like 1
Synonyms: DCAL, 1110034F20Rik, Ahcy-rs3, IRBIT
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229709
HGNC: HGNC:344
Homologene: 77353
Ddr1
Name: discoidin domain receptor family, member 1
Synonyms: CD167a, Cak
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12305
HGNC: HGNC:2730
Homologene: 68212
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: 4930542A03Rik, USH1D, mdfw, ahl, bob, nmf112, nmf181, nmf252, sals
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Idh2
Name: isocitrate dehydrogenase 2 (NADP+), mitochondrial
Synonyms: Idh-2, IDPm
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269951
HGNC: HGNC:5383
Homologene: 37590
Bbs1
Name: Bardet-Biedl syndrome 1
Synonyms: D19Ertd609e
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 52028
VEGA: 19
HGNC: HGNC:966
Homologene: 11641
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Klhl14
Name: kelch-like 14
Synonyms: 6330403N15Rik, printor
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225266
Homologene: 28121
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Lama4
Name: laminin, alpha 4
Synonyms: laminin [a]4
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16775
HGNC: HGNC:6484
Homologene: 37604
Tmem209
Name: transmembrane protein 209
Synonyms: 2700094F01Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 72649
Homologene: 18021
Ccny
Name: cyclin Y
Synonyms: 4631402G10Rik, 3110050L10Rik, 1700025H17Rik, 5730405I09Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67974
VEGA: 18
Homologene: 12219
Rnf135
Name: ring finger protein 135
Synonyms: U 2-3-0, MGC13061, 0610037N03Rik, 2410006N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71956
Homologene: 12427
Slc4a11
Name: solute carrier family 4, sodium bicarbonate transporter-like, member 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269356
Homologene: 12931
Pard3b
Name: par-3 family cell polarity regulator beta
Synonyms: 2810455B10Rik, PAR3beta, PAR3L, PAR3B, 2010002N16Rik, Als2cr19, 1810008K04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72823
Homologene: 35389
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Gpr179
Name: G protein-coupled receptor 179
Synonyms: 5330439C02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217143
Homologene: 34917
Spock3
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 3
Synonyms: testican 3, 2900045C01Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72902
Homologene: 9662
Abca14
Name: ATP-binding cassette, sub-family A member 14
Synonyms: 1700110B15Rik, 4930539G24Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67928
Homologene: 86128
Vmn2r94
Name: vomeronasal 2, receptor 94
Synonyms: EG665227
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 665227
Homologene: 129751
Dhrs1
Name: dehydrogenase/reductase 1
Synonyms: 1110029G07Rik, dehydrogenase/reductase (SDR family) member 1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52585
Homologene: 41696
Tmprss11f
Name: transmembrane protease, serine 11f
Synonyms: 4732406D01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243083
Homologene: 65356
Bean1
Name: brain expressed, associated with Nedd4, 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 65115
Homologene: 110172
Ttc7
Name: tetratricopeptide repeat domain 7
Synonyms: 1110035E02Rik, 1700007L07Rik, hea, fsn
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 225049
Homologene: 12515
Abcc2
Name: ATP-binding cassette, sub-family member 2
Synonyms: multidrug resistance protein 2, Mrp2, Cmoat
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12780
HGNC: HGNC:53
Homologene: 68052
Clip1
Name: CAP-GLY domain containing linker protein 1
Synonyms: cytoplasmic linker protein 50, Clip50, CLIP-170, 1110007I12Rik, 4631429H07Rik, Rsn, Clip 170, restin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56430
Homologene: 74455
Vmn2r112
Name: vomeronasal 2, receptor 112
Synonyms: EG628185
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 628185
Homologene: 86604
Lrfn2
Name: leucine rich repeat and fibronectin type III domain containing 2
Synonyms: 5730420O05Rik, SALM1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 70530
Homologene: 19182
Uqcrc1
Name: ubiquinol-cytochrome c reductase core protein 1
Synonyms: 1110032G10Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22273
Homologene: 2525
Itih3
Name: inter-alpha trypsin inhibitor, heavy chain 3
Synonyms: Intin3, Itih-3
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 16426
HGNC: HGNC:6168
Homologene: 1669
Fhod3
Name: formin homology 2 domain containing 3
Synonyms: A930009H06Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225288
VEGA: 18
Homologene: 45323
Vmn2r87
Name: vomeronasal 2, receptor 87
Synonyms: EG625131
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 625131
Homologene: 129606
Tyk2
Name: tyrosine kinase 2
Synonyms: JTK1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54721
VEGA: 9
Homologene: 20712
Or4k41
Name: olfactory receptor family 4 subfamily K member 41
Synonyms: GA_x6K02T2Q125-72500603-72501520, MOR248-15, Olfr1287
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 257935
Tcerg1l
Name: transcription elongation regulator 1-like
Synonyms: 5730476P14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70571
Homologene: 52165
Mindy4
Name: MINDY lysine 48 deubiquitinase 4
Synonyms: LOC384387, C330043M08Rik, Fam188b
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 330323
Homologene: 49991
Tdrd9
Name: tudor domain containing 9
Synonyms: 4930441E05Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74691
Homologene: 14311
Top6bl
Name: TOP6B like initiator of meiotic double strand breaks
Synonyms: Top6bl, Gm960
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 381196
VEGA: 19
Homologene: 69381
Zfp964
Name: zinc finger protein 964
Synonyms: Gm7187
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 636741
Homologene: 130114
Ly9
Name: lymphocyte antigen 9
Synonyms: T100, Lgp100, CD229, SLAMF3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 17085
HGNC: HGNC:6730
Homologene: 1759
Tex47
Name: testis expressed 47
Synonyms: 4921511H03Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70920
Homologene: 41723
Or1b1
Name: olfactory receptor family 1 subfamily B member 1
Synonyms: GA_x6K02T2NLDC-33797415-33796462, MOR158-1, Olfr362
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259053
HGNC: HGNC:8181
Homologene: 17479
Prl8a1
Name: prolactin family 8, subfamily a, member 1
Synonyms: PLP-Cd, 1600017L04Rik, 3830403L08Rik, Plpcd, Prlpc4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73244
Npffr1
Name: neuropeptide FF receptor 1
Synonyms: LOC237362, NPFF1, Gpr147, NPFF1R
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237362
Homologene: 23348
Adpgk
Name: ADP-dependent glucokinase
Synonyms: 2610017G09Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 72141
VEGA: 9
Homologene: 41739
Micall2
Name: MICAL-like 2
Synonyms: Jrab, MICAL-L2, A930021H16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231830
Homologene: 85155
Vmn1r160
Name: vomeronasal 1 receptor 160
Synonyms: Gm6178
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 620758
Homologene: 104166
Nme6
Name: NME/NM23 nucleoside diphosphate kinase 6
Synonyms: nm23-M6, non-metastatic cells 6, protein expressed in (nucleoside-diphosphate kinase)
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 54369
Homologene: 4231
Echs1
Name: enoyl Coenzyme A hydratase, short chain, 1, mitochondrial
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 93747
HGNC: HGNC:3151
Homologene: 3018
Or1p4-ps1
Name: olfactory receptor family 1 subfamily P member 4, pseudogene 1
Synonyms: GA_x6K02T2P1NL-4449217-4450187, MOR133-2, Olfr409-ps1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258131
Krtap5-24
Name: keratin associated protein 5-24
Synonyms: Gm40460
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 105244938
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 62,637,867 bp
  • T to G, chromosome 1 at 72,343,031 bp
  • T to C, chromosome 1 at 135,386,806 bp
  • T to C, chromosome 1 at 155,705,267 bp
  • A to T, chromosome 1 at 165,880,458 bp
  • A to T, chromosome 1 at 171,593,897 bp
  • C to A, chromosome 2 at 37,105,511 bp
  • C to T, chromosome 2 at 76,909,122 bp
  • A to G, chromosome 2 at 111,449,622 bp
  • T to G, chromosome 2 at 130,687,220 bp
  • C to T, chromosome 3 at 104,050,825 bp
  • C to T, chromosome 3 at 107,672,062 bp
  • T to A, chromosome 4 at 18,051,820 bp
  • A to T, chromosome 4 at 43,176,484 bp
  • A to G, chromosome 4 at 123,355,243 bp
  • G to T, chromosome 4 at 136,934,539 bp
  • A to T, chromosome 5 at 7,305,115 bp
  • A to T, chromosome 5 at 81,726,669 bp
  • A to C, chromosome 5 at 86,539,759 bp
  • A to T, chromosome 5 at 123,579,502 bp
  • T to A, chromosome 5 at 139,717,499 bp
  • T to A, chromosome 6 at 3,536,967 bp
  • T to A, chromosome 6 at 30,497,943 bp
  • T to C, chromosome 6 at 55,278,238 bp
  • T to A, chromosome 6 at 88,766,324 bp
  • G to A, chromosome 7 at 22,872,049 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • A to T, chromosome 7 at 97,678,964 bp
  • T to A, chromosome 7 at 120,216,383 bp
  • C to T, chromosome 7 at 138,397,531 bp
  • A to C, chromosome 7 at 140,108,118 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • T to A, chromosome 8 at 62,951,952 bp
  • G to A, chromosome 8 at 69,663,755 bp
  • A to G, chromosome 8 at 90,933,840 bp
  • A to T, chromosome 8 at 104,216,978 bp
  • A to G, chromosome 8 at 106,742,213 bp
  • T to C, chromosome 9 at 21,116,167 bp
  • G to A, chromosome 9 at 21,341,857 bp
  • G to A, chromosome 9 at 21,757,698 bp
  • A to G, chromosome 9 at 59,310,340 bp
  • G to A, chromosome 9 at 106,222,635 bp
  • C to T, chromosome 9 at 107,946,134 bp
  • C to T, chromosome 9 at 108,937,118 bp
  • T to G, chromosome 9 at 109,839,638 bp
  • T to A, chromosome 9 at 113,880,183 bp
  • T to A, chromosome 10 at 39,097,198 bp
  • G to T, chromosome 10 at 60,307,505 bp
  • A to G, chromosome 10 at 61,614,160 bp
  • A to C, chromosome 10 at 130,472,236 bp
  • A to G, chromosome 11 at 30,117,800 bp
  • T to C, chromosome 11 at 74,317,123 bp
  • C to T, chromosome 11 at 80,184,131 bp
  • T to C, chromosome 11 at 97,335,764 bp
  • A to T, chromosome 11 at 98,010,366 bp
  • A to T, chromosome 12 at 55,289,668 bp
  • A to G, chromosome 12 at 112,013,284 bp
  • G to A, chromosome 13 at 27,582,086 bp
  • G to A, chromosome 13 at 94,542,840 bp
  • A to G, chromosome 14 at 30,915,678 bp
  • G to A, chromosome 14 at 55,739,947 bp
  • A to T, chromosome 14 at 79,390,576 bp
  • T to A, chromosome 15 at 47,741,238 bp
  • T to C, chromosome 15 at 101,710,750 bp
  • A to T, chromosome 16 at 87,432,342 bp
  • A to G, chromosome 17 at 18,244,073 bp
  • A to G, chromosome 17 at 22,618,631 bp
  • C to T, chromosome 17 at 24,983,140 bp
  • A to C, chromosome 17 at 35,682,664 bp
  • A to C, chromosome 17 at 49,070,348 bp
  • T to A, chromosome 17 at 87,330,092 bp
  • T to G, chromosome 18 at 9,345,235 bp
  • T to G, chromosome 18 at 21,558,163 bp
  • A to T, chromosome 18 at 24,596,329 bp
  • G to A, chromosome 18 at 25,056,395 bp
  • G to A, chromosome 18 at 35,239,533 bp
  • A to G, chromosome 19 at 4,649,693 bp
  • A to C, chromosome 19 at 4,892,926 bp
  • T to G, chromosome 19 at 43,807,132 bp
  • T to A, chromosome 19 at 55,302,555 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8892 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068695-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.