Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8892Btlr/Mmmh
Stock Number:
068695-MU
Citation ID:
RRID:MMRRC_068695-MU
Other Names:
R8892 (G1)
Major Collection:

Strain Information

Pou2f1
Name: POU domain, class 2, transcription factor 1
Synonyms: Oct-1C, Oct-1B, Oct-1A, oct-1, Otf-1, Otf1, 2810482H01Rik, Oct-1z, Oct1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 18986
HGNC: HGNC:9212
Homologene: 37658
Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: beta fodrin, Spnb-2, spectrin G, brain spectrin, elf3, elf1, 9930031C03Rik, non-erythrocytic, Spnb2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Krt5
Name: keratin 5
Synonyms: 3300001P10Rik, Tfip8, K5, Krt2-5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110308
HGNC: HGNC:6442
Homologene: 55461
Tlr9
Name: toll-like receptor 9
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 81897
Homologene: 68126
Macf1
Name: microtubule-actin crosslinking factor 1
Synonyms: Acf7, Aclp7, trabeculin alpha
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 11426
Homologene: 136191
Ctnna1
Name: catenin alpha 1
Synonyms: alpha(E)-catenin, alpha E catenin, Catna1, 2010010M04Rik, catenin (cadherin associated protein), alpha 1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12385
VEGA: 18
HGNC: HGNC:2509
Homologene: 1433
Slc44a2
Name: solute carrier family 44, member 2
Synonyms: 1110028E10Rik, CTL2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68682
VEGA: 9
Homologene: 10711
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 62,637,867 bp
  • T to G, chromosome 1 at 72,343,031 bp
  • T to C, chromosome 1 at 135,386,806 bp
  • T to C, chromosome 1 at 155,705,267 bp
  • A to T, chromosome 1 at 165,880,458 bp
  • A to T, chromosome 1 at 171,593,897 bp
  • C to A, chromosome 2 at 37,105,511 bp
  • C to T, chromosome 2 at 76,909,122 bp
  • A to G, chromosome 2 at 111,449,622 bp
  • T to G, chromosome 2 at 130,687,220 bp
  • C to T, chromosome 3 at 104,050,825 bp
  • C to T, chromosome 3 at 107,672,062 bp
  • T to A, chromosome 4 at 18,051,820 bp
  • A to T, chromosome 4 at 43,176,484 bp
  • A to G, chromosome 4 at 123,355,243 bp
  • G to T, chromosome 4 at 136,934,539 bp
  • A to T, chromosome 5 at 7,305,115 bp
  • A to T, chromosome 5 at 81,726,669 bp
  • A to C, chromosome 5 at 86,539,759 bp
  • A to T, chromosome 5 at 123,579,502 bp
  • T to A, chromosome 5 at 139,717,499 bp
  • T to A, chromosome 6 at 3,536,967 bp
  • T to A, chromosome 6 at 30,497,943 bp
  • T to C, chromosome 6 at 55,278,238 bp
  • T to A, chromosome 6 at 88,766,324 bp
  • G to A, chromosome 7 at 22,872,049 bp
  • TCCCAGG to T, chromosome 7 at 80,098,331 bp
  • A to T, chromosome 7 at 97,678,964 bp
  • T to A, chromosome 7 at 120,216,383 bp
  • C to T, chromosome 7 at 138,397,531 bp
  • A to C, chromosome 7 at 140,108,118 bp
  • ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG to ACCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAGCCACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAGGAACTACAGCCTCCCTTGCAGCCCCCACAG, chromosome 7 at 142,240,713 bp
  • T to A, chromosome 8 at 62,951,952 bp
  • G to A, chromosome 8 at 69,663,755 bp
  • A to G, chromosome 8 at 90,933,840 bp
  • A to T, chromosome 8 at 104,216,978 bp
  • A to G, chromosome 8 at 106,742,213 bp
  • T to C, chromosome 9 at 21,116,167 bp
  • G to A, chromosome 9 at 21,341,857 bp
  • G to A, chromosome 9 at 21,757,698 bp
  • A to G, chromosome 9 at 59,310,340 bp
  • G to A, chromosome 9 at 106,222,635 bp
  • C to T, chromosome 9 at 107,946,134 bp
  • C to T, chromosome 9 at 108,937,118 bp
  • T to G, chromosome 9 at 109,839,638 bp
  • T to A, chromosome 9 at 113,880,183 bp
  • T to A, chromosome 10 at 39,097,198 bp
  • G to T, chromosome 10 at 60,307,505 bp
  • A to G, chromosome 10 at 61,614,160 bp
  • A to C, chromosome 10 at 130,472,236 bp
  • A to G, chromosome 11 at 30,117,800 bp
  • T to C, chromosome 11 at 74,317,123 bp
  • C to T, chromosome 11 at 80,184,131 bp
  • T to C, chromosome 11 at 97,335,764 bp
  • A to T, chromosome 11 at 98,010,366 bp
  • A to T, chromosome 12 at 55,289,668 bp
  • A to G, chromosome 12 at 112,013,284 bp
  • G to A, chromosome 13 at 27,582,086 bp
  • G to A, chromosome 13 at 94,542,840 bp
  • A to G, chromosome 14 at 30,915,678 bp
  • G to A, chromosome 14 at 55,739,947 bp
  • A to T, chromosome 14 at 79,390,576 bp
  • T to A, chromosome 15 at 47,741,238 bp
  • T to C, chromosome 15 at 101,710,750 bp
  • A to T, chromosome 16 at 87,432,342 bp
  • A to G, chromosome 17 at 18,244,073 bp
  • A to G, chromosome 17 at 22,618,631 bp
  • C to T, chromosome 17 at 24,983,140 bp
  • A to C, chromosome 17 at 35,682,664 bp
  • A to C, chromosome 17 at 49,070,348 bp
  • T to A, chromosome 17 at 87,330,092 bp
  • T to G, chromosome 18 at 9,345,235 bp
  • T to G, chromosome 18 at 21,558,163 bp
  • A to T, chromosome 18 at 24,596,329 bp
  • G to A, chromosome 18 at 25,056,395 bp
  • G to A, chromosome 18 at 35,239,533 bp
  • A to G, chromosome 19 at 4,649,693 bp
  • A to C, chromosome 19 at 4,892,926 bp
  • T to G, chromosome 19 at 43,807,132 bp
  • T to A, chromosome 19 at 55,302,555 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8892 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068695-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.