Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8918Btlr/Mmmh
Stock Number:
068705-MU
Citation ID:
RRID:MMRRC_068705-MU
Other Names:
R8918 (G1)
Major Collection:

Strain Information

Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Pelp1
Name: proline, glutamic acid and leucine rich protein 1
Synonyms: 4930563C04Rik, MNAR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75273
Homologene: 8664
Rorb
Name: RAR-related orphan receptor beta
Synonyms: RZR-beta, Nr1f2, Rorbeta, hstp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225998
Homologene: 38250
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Rock2
Name: Rho-associated coiled-coil containing protein kinase 2
Synonyms: Rock-II, B230113H15Rik, Rho-kinase, ROKalpha, Rock2m
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19878
VEGA: 12
Homologene: 21010
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 93,201,422 bp
  • T to A, chromosome 1 at 188,537,820 bp
  • G to A, chromosome 2 at 20,743,922 bp
  • A to G, chromosome 2 at 20,806,435 bp
  • A to T, chromosome 2 at 40,725,881 bp
  • A to T, chromosome 2 at 76,740,518 bp
  • T to C, chromosome 2 at 101,641,753 bp
  • A to G, chromosome 2 at 105,832,255 bp
  • A to C, chromosome 2 at 177,266,758 bp
  • T to C, chromosome 3 at 80,692,399 bp
  • T to C, chromosome 3 at 95,659,881 bp
  • A to T, chromosome 3 at 107,985,066 bp
  • A to G, chromosome 3 at 126,943,731 bp
  • T to A, chromosome 4 at 32,744,579 bp
  • T to A, chromosome 4 at 111,883,950 bp
  • C to A, chromosome 4 at 116,163,773 bp
  • T to A, chromosome 4 at 145,046,303 bp
  • T to C, chromosome 4 at 147,756,166 bp
  • A to G, chromosome 5 at 13,523,132 bp
  • C to T, chromosome 5 at 112,875,007 bp
  • T to C, chromosome 5 at 114,195,254 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to G, chromosome 6 at 64,730,257 bp
  • C to T, chromosome 6 at 83,031,343 bp
  • T to C, chromosome 7 at 130,626,093 bp
  • C to T, chromosome 8 at 127,371,530 bp
  • T to C, chromosome 9 at 7,561,484 bp
  • T to C, chromosome 9 at 38,292,089 bp
  • A to G, chromosome 9 at 86,769,558 bp
  • C to T, chromosome 10 at 18,635,705 bp
  • A to T, chromosome 10 at 33,139,121 bp
  • A to G, chromosome 10 at 79,948,931 bp
  • A to T, chromosome 10 at 89,717,195 bp
  • A to G, chromosome 11 at 42,135,493 bp
  • A to G, chromosome 11 at 70,405,679 bp
  • T to C, chromosome 11 at 80,095,647 bp
  • T to C, chromosome 11 at 84,152,704 bp
  • A to G, chromosome 11 at 87,889,458 bp
  • C to T, chromosome 12 at 16,940,421 bp
  • G to T, chromosome 12 at 80,637,508 bp
  • G to A, chromosome 12 at 91,537,437 bp
  • A to G, chromosome 12 at 112,606,269 bp
  • T to C, chromosome 12 at 114,615,933 bp
  • T to G, chromosome 13 at 33,495,148 bp
  • T to A, chromosome 13 at 65,295,715 bp
  • G to A, chromosome 16 at 37,134,530 bp
  • G to A, chromosome 17 at 8,941,231 bp
  • G to A, chromosome 17 at 23,607,142 bp
  • A to G, chromosome 17 at 24,912,753 bp
  • A to T, chromosome 17 at 56,575,975 bp
  • A to G, chromosome 17 at 84,599,193 bp
  • A to G, chromosome 18 at 34,837,597 bp
  • A to G, chromosome 18 at 37,722,595 bp
  • G to T, chromosome 18 at 43,967,020 bp
  • C to T, chromosome 18 at 60,692,011 bp
  • T to C, chromosome 19 at 3,358,258 bp
  • T to A, chromosome 19 at 18,937,992 bp
  • T to C, chromosome 19 at 29,719,441 bp
  • A to C, chromosome 19 at 40,913,426 bp
  • A to G, chromosome 19 at 55,191,568 bp
  • A to T, chromosome 19 at 61,226,283 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8918 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068705-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.