Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8918Btlr/Mmmh
Stock Number:
068705-MU
Citation ID:
RRID:MMRRC_068705-MU
Other Names:
R8918 (G1)
Major Collection:

Strain Information

Ank2
Name: ankyrin 2, brain
Synonyms: ankyrin B, Ank-2, Ankyrin-2, Ankyrin-B, Gm4392
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 109676
HGNC: HGNC:493
Gria2
Name: glutamate receptor, ionotropic, AMPA2 (alpha 2)
Synonyms: GluR-B, GluR2, Glur-2, Glur2, GluA2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14800
HGNC: HGNC:4572
Homologene: 20225
Pelp1
Name: proline, glutamic acid and leucine rich protein 1
Synonyms: 4930563C04Rik, MNAR
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75273
Homologene: 8664
Rorb
Name: RAR-related orphan receptor beta
Synonyms: RZR-beta, Nr1f2, Rorbeta, hstp
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 225998
Homologene: 38250
Pard3
Name: par-3 family cell polarity regulator
Synonyms: ASIP, D8Ertd580e, PAR-3, Par3, Pard3a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 93742
Homologene: 10489
Rock2
Name: Rho-associated coiled-coil containing protein kinase 2
Synonyms: Rock-II, B230113H15Rik, Rho-kinase, ROKalpha, Rock2m
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 19878
VEGA: 12
Homologene: 21010
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Tacc2
Name: transforming, acidic coiled-coil containing protein 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 57752
Homologene: 5087
Mcl1
Name: myeloid cell leukemia sequence 1
Synonyms: Mcl-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17210
HGNC: HGNC:6943
Homologene: 7413
Mdn1
Name: midasin AAA ATPase 1
Synonyms: LOC213784, 4833432B22Rik, D4Abb1e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100019
Homologene: 39689
Safb2
Name: scaffold attachment factor B2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224902
Homologene: 35210
Tshr
Name: thyroid stimulating hormone receptor
Synonyms: hyt, pet, hypothroid
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 22095
Homologene: 315
Rag1
Name: recombination activating 1
Synonyms: Rag-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19373
HGNC: HGNC:9831
Homologene: 387
Atoh1
Name: atonal bHLH transcription factor 1
Synonyms: Math1, Hath1, bHLHa14
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 11921
HGNC: HGNC:797
Homologene: 31297
Snap91
Name: synaptosomal-associated protein 91
Synonyms: F1-20, 91kDa, AP180
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20616
Homologene: 8429
Kdm3b
Name: KDM3B lysine (K)-specific demethylase 3B
Synonyms: 5830462I21Rik, JHDM2B, Jmjd1b
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 277250
VEGA: 18
HGNC: HGNC:1337
Homologene: 41145
Cpt1a
Name: carnitine palmitoyltransferase 1a, liver
Synonyms: CPTI, L-CPT I, Cpt1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12894
VEGA: 19
HGNC: HGNC:2328
Homologene: 1413
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Zfp369
Name: zinc finger protein 369
Synonyms: NRIF2, D230020H11Rik, B930030B22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 170936
Homologene: 129707
Erh
Name: ERH mRNA splicing and mitosis factor
Synonyms: Mer, Prei1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13877
HGNC: HGNC:3447
Homologene: 3274
Mapk8ip3
Name: mitogen-activated protein kinase 8 interacting protein 3
Synonyms: JNK-interacting protein 3, Jip3, JSAP1, JUN/SAPK-associated protein 1, JSAP1d, JSAP1c, JSAP1b, JSAP1a, c-Jun NH2-terminal kinase (JNK)/stress-activated protein kinase-associated protein 1, sunday driver 2, Syd2, D17Wsu15e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 30957
HGNC: HGNC:6884
Homologene: 22790
Zfp984
Name: zinc finger protein 984
Synonyms: Gm13157
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100041677
Homologene: 133076
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Spink5
Name: serine peptidase inhibitor, Kazal type 5
Synonyms: LEKT1, 2310065D10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 72432
Homologene: 4987
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Zscan10
Name: zinc finger and SCAN domain containing 10
Synonyms: Zscan10, Zfp206
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 332221
Homologene: 13122
Acacb
Name: acetyl-Coenzyme A carboxylase beta
Synonyms: Accb, Acc2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100705
HGNC: HGNC:85
Homologene: 74382
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, LOC269160, A930037M10Rik, Ushrn, Ush2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Plekhh2
Name: pleckstrin homology domain containing, family H (with MyTH4 domain) member 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213556
VEGA: 17
Homologene: 35317
Brd10
Name: bromodomain containing 10
Synonyms: Gm9832, 9930021J03Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240613
Homologene: 19046
Lrp1b
Name: low density lipoprotein-related protein 1B
Synonyms: 9630004P12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 94217
HGNC: HGNC:6693
Homologene: 56810
Arid3a
Name: AT-rich interaction domain 3A
Synonyms: Bright, Dri1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13496
HGNC: HGNC:3031
Homologene: 124247
Csf2ra
Name: colony stimulating factor 2 receptor, alpha, low-affinity (granulocyte-macrophage)
Synonyms: CD116, Csfgmra, GM-CSF-Ra, GM-CSFRalpha
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12982
VEGA: 19
HGNC: HGNC:2435
Homologene: 48406
Sema3a
Name: sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
Synonyms: SemD, semaphorin III, sema III, collapsin-1, Semad
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20346
Homologene: 31358
Stxbp5l
Name: syntaxin binding protein 5-like
Synonyms: t2md1, LLGL4, A830015P08Rik, insulin level locus 1, tomosyn-2, T2dm1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 207227
Homologene: 18173
Gm11437
Name: predicted gene 11437
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 628813
Homologene: 82346
Arfgef3
Name: ARFGEF family member 3
Synonyms: B930094H20Rik, D10Bwg1379e, BIG3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215821
VEGA: 10
Homologene: 41366
Elp4
Name: elongator acetyltransferase complex subunit 4
Synonyms: Paxneb, A330107A17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 77766
HGNC: HGNC:1171
Homologene: 32433
Tectb
Name: tectorin beta
Synonyms: [b]-tectorin, Tctnb
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21684
Homologene: 7568
Zfp518a
Name: zinc finger protein 518A
Synonyms: 6330417C12Rik, 2810401C22Rik, Zfp518
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72672
VEGA: 19
Homologene: 19378
Actr6
Name: ARP6 actin-related protein 6
Synonyms: ArpX, Arp6, CDA12, 2010200J04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67019
VEGA: 10
Homologene: 6451
Myo18b
Name: myosin XVIIIb
Synonyms: 4932408L24Rik, 4933411E19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 74376
Homologene: 53435
Mmp8
Name: matrix metallopeptidase 8
Synonyms: Collagenase-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17394
VEGA: 9
HGNC: HGNC:7175
Homologene: 22482
Slc5a9
Name: solute carrier family 5 (sodium/glucose cotransporter), member 9
Synonyms: SGLT4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230612
Homologene: 17081
Crocc2
Name: ciliary rootlet coiled-coil, rootletin family member 2
Synonyms: LOC381284, E030010N08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381284
Homologene: 141152
Inf2
Name: inverted formin, FH2 and WH2 domain containing
Synonyms: EG629699, 2610204M08Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 70435
VEGA: 12
Homologene: 82406
Gstm2
Name: glutathione S-transferase, mu 2
Synonyms: Gstb-2, Gstb2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 14863
Homologene: 121492
Dok1
Name: docking protein 1
Synonyms: p62DOK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13448
HGNC: HGNC:2990
Homologene: 1057
Trdn
Name: triadin
Synonyms: 2310045H21Rik, triadin-3, triadin-2, triadin-1, triadin 3, triadin 2, triadin 1, EG432451
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 76757
VEGA: 10
Homologene: 38137
Gabra1
Name: gamma-aminobutyric acid type A receptor subunit alpha 1
Synonyms: GABAA alpha 1, Gabra-1, GABAAR alpha1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14394
HGNC: HGNC:4075
Homologene: 629
Or4d2b
Name: olfactory receptor family 4 subfamily D member 2B
Synonyms: GA_x6K02T2PAEV-9536824-9535889, MOR240-3, Olfr462
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258406
HGNC: HGNC:8294
Homologene: 64870
Ndst1
Name: N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1
Synonyms: glucosaminyl N-deacetylase/N-sulfotransferase 1, Hsst, 1200015G06Rik, Ndst-1, b2b2230Clo
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 15531
VEGA: 18
HGNC: HGNC:7680
Homologene: 20386
Zfp1010
Name: zinc finger protein 1010
Synonyms: Gm14409
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 115489547
Serpinb9g
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9g
Synonyms: ovalbumin, 1600002F03Rik, NK21B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 93806
HGNC: HGNC:8955
Homologene: 69093
Tspan1
Name: tetraspanin 1
Synonyms: 9030418M05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66805
Homologene: 21170
Pcdhgb4
Name: protocadherin gamma subfamily B, 4
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93701
HGNC: HGNC:8711
Homologene: 74507
Or8c18
Name: olfactory receptor family 8 subfamily C member 18
Synonyms: GA_x6K02T2PVTD-31985209-31986136, MOR170-10P, Olfr896
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258030
VEGA: 9
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 93,201,422 bp
  • T to A, chromosome 1 at 188,537,820 bp
  • G to A, chromosome 2 at 20,743,922 bp
  • A to G, chromosome 2 at 20,806,435 bp
  • A to T, chromosome 2 at 40,725,881 bp
  • A to T, chromosome 2 at 76,740,518 bp
  • T to C, chromosome 2 at 101,641,753 bp
  • A to G, chromosome 2 at 105,832,255 bp
  • A to C, chromosome 2 at 177,266,758 bp
  • T to C, chromosome 3 at 80,692,399 bp
  • T to C, chromosome 3 at 95,659,881 bp
  • A to T, chromosome 3 at 107,985,066 bp
  • A to G, chromosome 3 at 126,943,731 bp
  • T to A, chromosome 4 at 32,744,579 bp
  • T to A, chromosome 4 at 111,883,950 bp
  • C to A, chromosome 4 at 116,163,773 bp
  • T to A, chromosome 4 at 145,046,303 bp
  • T to C, chromosome 4 at 147,756,166 bp
  • A to G, chromosome 5 at 13,523,132 bp
  • C to T, chromosome 5 at 112,875,007 bp
  • T to C, chromosome 5 at 114,195,254 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to G, chromosome 6 at 64,730,257 bp
  • C to T, chromosome 6 at 83,031,343 bp
  • T to C, chromosome 7 at 130,626,093 bp
  • C to T, chromosome 8 at 127,371,530 bp
  • T to C, chromosome 9 at 7,561,484 bp
  • T to C, chromosome 9 at 38,292,089 bp
  • A to G, chromosome 9 at 86,769,558 bp
  • C to T, chromosome 10 at 18,635,705 bp
  • A to T, chromosome 10 at 33,139,121 bp
  • A to G, chromosome 10 at 79,948,931 bp
  • A to T, chromosome 10 at 89,717,195 bp
  • A to G, chromosome 11 at 42,135,493 bp
  • A to G, chromosome 11 at 70,405,679 bp
  • T to C, chromosome 11 at 80,095,647 bp
  • T to C, chromosome 11 at 84,152,704 bp
  • A to G, chromosome 11 at 87,889,458 bp
  • C to T, chromosome 12 at 16,940,421 bp
  • G to T, chromosome 12 at 80,637,508 bp
  • G to A, chromosome 12 at 91,537,437 bp
  • A to G, chromosome 12 at 112,606,269 bp
  • T to C, chromosome 12 at 114,615,933 bp
  • T to G, chromosome 13 at 33,495,148 bp
  • T to A, chromosome 13 at 65,295,715 bp
  • G to A, chromosome 16 at 37,134,530 bp
  • G to A, chromosome 17 at 8,941,231 bp
  • G to A, chromosome 17 at 23,607,142 bp
  • A to G, chromosome 17 at 24,912,753 bp
  • A to T, chromosome 17 at 56,575,975 bp
  • A to G, chromosome 17 at 84,599,193 bp
  • A to G, chromosome 18 at 34,837,597 bp
  • A to G, chromosome 18 at 37,722,595 bp
  • G to T, chromosome 18 at 43,967,020 bp
  • C to T, chromosome 18 at 60,692,011 bp
  • T to C, chromosome 19 at 3,358,258 bp
  • T to A, chromosome 19 at 18,937,992 bp
  • T to C, chromosome 19 at 29,719,441 bp
  • A to C, chromosome 19 at 40,913,426 bp
  • A to G, chromosome 19 at 55,191,568 bp
  • A to T, chromosome 19 at 61,226,283 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8918 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068705-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.