Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8817Btlr/Mmmh
Stock Number:
068727-MU
Citation ID:
RRID:MMRRC_068727-MU
Other Names:
R8817 (G1)
Major Collection:

Strain Information

Sp4
Name: trans-acting transcription factor 4
Synonyms: HF1-b, HF-1b, 5730497N03Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20688
VEGA: 12
Homologene: 2341
Smarca4
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4
Synonyms: SNF2beta, Brg1, SW1/SNF, b2b692Clo, b2b508.1Clo
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20586
Homologene: 135927
Ptprz1
Name: protein tyrosine phosphatase receptor type Z, polypeptide 1
Synonyms: DSD-1-PG, phosphacan, PTPzeta, PTPbeta, Rptpbeta, Ptpz, Ptprz, RPTPz
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19283
HGNC: HGNC:9685
Homologene: 2136
Ubap2
Name: ubiquitin-associated protein 2
Synonyms: 1190005K07Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68926
Homologene: 73649
Ephx2
Name: epoxide hydrolase 2, cytoplasmic
Synonyms: Eph2, sEP, sEH
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13850
VEGA: 14
HGNC: HGNC:3402
Homologene: 37558
Gse1
Name: genetic suppressor element 1, coiled-coil protein
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382034
Homologene: 40964
Pcbp3
Name: poly(rC) binding protein 3
Synonyms: AlphaCP-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 59093
HGNC: HGNC:8651
Homologene: 23233
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 45,909,539 bp
  • A to G, chromosome 1 at 118,304,740 bp
  • A to T, chromosome 1 at 188,263,034 bp
  • T to C, chromosome 2 at 53,152,959 bp
  • T to A, chromosome 2 at 76,829,907 bp
  • T to C, chromosome 2 at 80,624,287 bp
  • A to G, chromosome 2 at 89,943,446 bp
  • A to G, chromosome 2 at 91,276,998 bp
  • T to G, chromosome 2 at 102,634,421 bp
  • A to T, chromosome 2 at 122,518,507 bp
  • A to T, chromosome 2 at 129,068,858 bp
  • G to A, chromosome 2 at 129,593,638 bp
  • G to A, chromosome 2 at 135,333,509 bp
  • T to A, chromosome 2 at 156,048,223 bp
  • A to G, chromosome 4 at 41,223,425 bp
  • A to G, chromosome 4 at 104,945,455 bp
  • A to G, chromosome 4 at 133,246,760 bp
  • A to G, chromosome 4 at 144,673,791 bp
  • A to G, chromosome 5 at 14,912,216 bp
  • T to C, chromosome 5 at 86,148,913 bp
  • G to T, chromosome 5 at 92,347,371 bp
  • G to T, chromosome 5 at 104,337,285 bp
  • T to C, chromosome 5 at 120,670,351 bp
  • T to A, chromosome 5 at 144,845,538 bp
  • A to T, chromosome 6 at 23,007,372 bp
  • A to T, chromosome 6 at 23,097,196 bp
  • T to C, chromosome 6 at 29,155,024 bp
  • T to A, chromosome 6 at 47,904,826 bp
  • A to G, chromosome 6 at 113,515,907 bp
  • G to A, chromosome 6 at 142,358,886 bp
  • C to A, chromosome 7 at 22,843,134 bp
  • T to C, chromosome 7 at 24,606,302 bp
  • T to A, chromosome 7 at 48,447,322 bp
  • T to C, chromosome 7 at 65,303,062 bp
  • T to A, chromosome 7 at 96,874,128 bp
  • A to T, chromosome 7 at 103,383,618 bp
  • A to G, chromosome 7 at 118,159,664 bp
  • G to A, chromosome 7 at 121,991,622 bp
  • T to C, chromosome 7 at 127,553,223 bp
  • T to C, chromosome 7 at 127,597,160 bp
  • A to C, chromosome 8 at 35,478,638 bp
  • G to A, chromosome 8 at 36,994,114 bp
  • A to G, chromosome 8 at 67,960,483 bp
  • A to T, chromosome 8 at 80,733,750 bp
  • G to A, chromosome 8 at 84,638,797 bp
  • C to T, chromosome 8 at 105,929,720 bp
  • T to C, chromosome 8 at 120,567,803 bp
  • T to A, chromosome 9 at 21,636,201 bp
  • C to T, chromosome 9 at 39,462,091 bp
  • G to T, chromosome 9 at 39,819,643 bp
  • G to T, chromosome 9 at 58,151,982 bp
  • T to C, chromosome 9 at 86,513,950 bp
  • A to T, chromosome 10 at 27,187,873 bp
  • T to C, chromosome 10 at 76,789,836 bp
  • TGTCACAGGT to TGT, chromosome 10 at 80,866,069 bp
  • A to G, chromosome 10 at 121,096,716 bp
  • A to T, chromosome 11 at 33,554,464 bp
  • G to A, chromosome 11 at 40,721,672 bp
  • T to C, chromosome 11 at 72,051,068 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • C to T, chromosome 12 at 65,120,557 bp
  • A to T, chromosome 12 at 118,261,889 bp
  • T to A, chromosome 13 at 11,735,623 bp
  • A to G, chromosome 13 at 26,770,085 bp
  • G to A, chromosome 13 at 65,034,562 bp
  • T to C, chromosome 13 at 100,212,699 bp
  • T to A, chromosome 14 at 41,153,598 bp
  • G to A, chromosome 14 at 48,252,673 bp
  • T to C, chromosome 14 at 52,140,599 bp
  • A to T, chromosome 14 at 64,030,636 bp
  • T to C, chromosome 14 at 66,107,276 bp
  • A to G, chromosome 15 at 85,818,573 bp
  • A to G, chromosome 17 at 37,952,382 bp
  • T to A, chromosome 19 at 32,486,347 bp
  • T to C, chromosome 19 at 43,755,674 bp
  • A to G, chromosome X at 151,886,997 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8817 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068727-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.