Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8912Btlr/Mmmh
Stock Number:
068765-MU
Citation ID:
RRID:MMRRC_068765-MU
Other Names:
R8912 (G1)
Major Collection:

Strain Information

Ippk
Name: inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Synonyms: 1810043M15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75678
VEGA: 13
Homologene: 41495
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: nonmuscle myosin heavy chain II-B, NMHC-B, SMemb, nonmuscle myosin heavy chain IIB, 9330167F11Rik, 5730504C04Rik, NMHC II-B, Myhn2, Myosin IIB, Myhn-2, myosin IIB, Fltn, Fltn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Srfbp1
Name: serum response factor binding protein 1
Synonyms: 2810036K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67222
VEGA: 18
Homologene: 12101
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 40,543,017 bp
  • T to C, chromosome 1 at 58,017,401 bp
  • A to G, chromosome 2 at 82,980,594 bp
  • C to T, chromosome 2 at 88,006,317 bp
  • A to G, chromosome 2 at 127,246,679 bp
  • T to C, chromosome 2 at 147,049,993 bp
  • A to G, chromosome 2 at 158,009,268 bp
  • T to C, chromosome 3 at 94,429,171 bp
  • A to G, chromosome 3 at 97,710,317 bp
  • A to G, chromosome 3 at 129,737,515 bp
  • T to A, chromosome 4 at 43,697,017 bp
  • T to A, chromosome 4 at 43,938,802 bp
  • A to G, chromosome 4 at 98,497,328 bp
  • A to G, chromosome 4 at 101,611,316 bp
  • T to C, chromosome 5 at 14,775,321 bp
  • T to G, chromosome 5 at 21,522,186 bp
  • T to C, chromosome 5 at 34,217,311 bp
  • C to A, chromosome 5 at 49,960,931 bp
  • T to A, chromosome 5 at 105,481,558 bp
  • C to T, chromosome 5 at 113,723,706 bp
  • G to T, chromosome 6 at 68,270,966 bp
  • A to G, chromosome 6 at 72,388,293 bp
  • A to T, chromosome 6 at 82,557,033 bp
  • A to G, chromosome 6 at 91,263,438 bp
  • A to G, chromosome 6 at 130,182,405 bp
  • A to T, chromosome 7 at 3,822,819 bp
  • G to T, chromosome 7 at 5,803,132 bp
  • A to T, chromosome 7 at 30,533,042 bp
  • G to T, chromosome 7 at 64,268,880 bp
  • T to A, chromosome 7 at 120,090,646 bp
  • A to T, chromosome 7 at 139,680,181 bp
  • A to T, chromosome 8 at 11,006,655 bp
  • C to A, chromosome 9 at 43,199,039 bp
  • C to G, chromosome 9 at 108,611,739 bp
  • T to A, chromosome 9 at 109,732,649 bp
  • T to C, chromosome 9 at 119,941,301 bp
  • A to C, chromosome 10 at 57,523,979 bp
  • G to T, chromosome 10 at 59,221,991 bp
  • A to G, chromosome 11 at 68,790,103 bp
  • T to C, chromosome 11 at 77,741,728 bp
  • A to T, chromosome 11 at 96,754,076 bp
  • C to T, chromosome 11 at 105,867,327 bp
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp
  • T to C, chromosome 11 at 119,352,660 bp
  • T to C, chromosome 12 at 24,516,861 bp
  • T to C, chromosome 12 at 44,598,583 bp
  • G to T, chromosome 12 at 80,637,508 bp
  • T to C, chromosome 12 at 112,815,703 bp
  • A to G, chromosome 13 at 49,450,037 bp
  • T to A, chromosome 13 at 51,144,397 bp
  • T to C, chromosome 13 at 59,727,322 bp
  • A to T, chromosome 13 at 74,327,204 bp
  • T to A, chromosome 13 at 76,157,242 bp
  • T to A, chromosome 13 at 90,898,860 bp
  • T to C, chromosome 14 at 18,220,030 bp
  • C to T, chromosome 14 at 32,526,254 bp
  • T to C, chromosome 14 at 44,403,781 bp
  • C to G, chromosome 14 at 53,418,809 bp
  • T to C, chromosome 15 at 76,593,235 bp
  • A to G, chromosome 15 at 101,628,185 bp
  • A to T, chromosome 16 at 17,389,366 bp
  • A to G, chromosome 16 at 59,035,900 bp
  • T to C, chromosome 17 at 7,800,946 bp
  • A to G, chromosome 17 at 23,819,601 bp
  • A to G, chromosome 17 at 31,850,945 bp
  • A to T, chromosome 17 at 34,113,484 bp
  • A to T, chromosome 17 at 38,335,429 bp
  • T to A, chromosome 18 at 20,582,821 bp
  • A to G, chromosome 18 at 52,490,614 bp
  • A to G, chromosome 18 at 86,461,048 bp
  • A to C, chromosome 19 at 40,913,426 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8912 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068765-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.