Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8912Btlr/Mmmh
Stock Number:
068765-MU
Citation ID:
RRID:MMRRC_068765-MU
Other Names:
R8912 (G1)
Major Collection:

Strain Information

Ippk
Name: inositol 1,3,4,5,6-pentakisphosphate 2-kinase
Synonyms: 1810043M15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 75678
VEGA: 13
Homologene: 41495
Nrcam
Name: neuronal cell adhesion molecule
Synonyms: Bravo, C030017F07Rik, C130076O07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 319504
VEGA: 12
HGNC: HGNC:7994
Homologene: 21041
Tti1
Name: TELO2 interacting protein 1
Synonyms: 2610036D13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75425
Homologene: 40969
Myh10
Name: myosin, heavy polypeptide 10, non-muscle
Synonyms: nonmuscle myosin heavy chain II-B, NMHC-B, SMemb, nonmuscle myosin heavy chain IIB, 9330167F11Rik, 5730504C04Rik, NMHC II-B, Myhn2, Myosin IIB, Myhn-2, myosin IIB, Fltn, Fltn
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77579
HGNC: HGNC:7568
Homologene: 55941
Patj
Name: PATJ, crumbs cell polarity complex component
Synonyms: Cipp, Inadl
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 12695
Homologene: 72199
Srfbp1
Name: serum response factor binding protein 1
Synonyms: 2810036K01Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 67222
VEGA: 18
Homologene: 12101
Ercc6
Name: excision repair cross-complementing rodent repair deficiency, complementation group 6
Synonyms: CS group B correcting gene, CSB, C130058G22Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 319955
VEGA: 14
HGNC: HGNC:3438
Homologene: 133552
Xrn2
Name: 5'-3' exoribonuclease 2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 24128
Homologene: 6927
Pi4ka
Name: phosphatidylinositol 4-kinase alpha
Synonyms: Pik4ca
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224020
HGNC: HGNC:8983
Homologene: 11171
Brd2
Name: bromodomain containing 2
Synonyms: Ring3, Frg-1, D17H6S113E, Fsrg1, Rnf3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14312
HGNC: HGNC:1103
Homologene: 74540
Nufip2
Name: nuclear FMR1 interacting protein 2
Synonyms: 9530056D24Rik, 1110001M19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 68564
Homologene: 10808
Srrm2
Name: serine/arginine repetitive matrix 2
Synonyms: 5033413A03Rik, SRm300
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 75956
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Sdha
Name: succinate dehydrogenase complex, subunit A, flavoprotein (Fp)
Synonyms: SDHF, SDH2, FP, 2310034D06Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66945
Homologene: 3073
Skic3
Name: SKI3 subunit of superkiller complex
Synonyms: Ttc37
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218343
VEGA: 13
Homologene: 40966
Taf1b
Name: TATA-box binding protein associated factor, RNA polymerase I, B
Synonyms: mTAFI68, 4930408G01Rik, A230108M10Rik, p63
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 21340
VEGA: 12
Homologene: 31331
Sgo2a
Name: shugoshin 2A
Synonyms: 5730576N04Rik, Tripin, 1110007N04Rik, D1Ertd8e, Sgol2, Sgol2a
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68549
Homologene: 51867
Arih2
Name: ariadne RBR E3 ubiquitin protein ligase 2
Synonyms: TRIAD1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23807
HGNC: HGNC:690
Homologene: 48424
Arhgap33
Name: Rho GTPase activating protein 33
Synonyms: Tcgap, Snx26, NOMA-GAP
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233071
Homologene: 76448
Adgra3
Name: adhesion G protein-coupled receptor A3
Synonyms: 3830613O22Rik, Tem5-like, Gpr125
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 70693
Homologene: 19235
Erh
Name: ERH mRNA splicing and mitosis factor
Synonyms: Mer, Prei1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13877
HGNC: HGNC:3447
Homologene: 3274
Spin1
Name: spindlin 1
Synonyms: Spin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20729
VEGA: 13
Homologene: 55983
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Reck
Name: reversion-inducing-cysteine-rich protein with kazal motifs
Synonyms: St15
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 53614
Homologene: 9622
Serinc1
Name: serine incorporator 1
Synonyms: TMS-2, 1500011D18Rik, Tde1l, Tde2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 56442
Homologene: 41334
Dnajc6
Name: DnaJ heat shock protein family (Hsp40) member C6
Synonyms: 2810027M23Rik, auxilin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72685
Homologene: 8865
Cfap46
Name: cilia and flagella associated protein 46
Synonyms: Ttc40, 9330101J02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 212124
Zfyve28
Name: zinc finger, FYVE domain containing 28
Synonyms: 9630058O20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231125
Homologene: 15119
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Dnah3
Name: dynein, axonemal, heavy chain 3
Synonyms: Dnahc3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381917
HGNC: HGNC:2949
Homologene: 19674
Trpm1
Name: transient receptor potential cation channel, subfamily M, member 1
Synonyms: Mlsn1, 4732499L03Rik, melastatin, LTRPC1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17364
HGNC: HGNC:7146
Homologene: 19940
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Fbxw26
Name: F-box and WD-40 domain protein 26
Synonyms: Gm5163
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 382109
Homologene: 110776
Sik1
Name: salt inducible kinase 1
Synonyms: Msk, Snf1lk
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17691
VEGA: 17
Homologene: 7847
Fbxl13
Name: F-box and leucine-rich repeat protein 13
Synonyms: 4921539K22Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320118
Homologene: 27057
Ttc21a
Name: tetratricopeptide repeat domain 21A
Synonyms: 4921538N17Rik, Thm2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74052
Homologene: 14728
Irs2
Name: insulin receptor substrate 2
Synonyms: Irs-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 384783
HGNC: HGNC:6126
Homologene: 2778
Pde4dip
Name: phosphodiesterase 4D interacting protein (myomegalin)
Synonyms: D3Bwg1078e, 4732458A06Rik, D130016K21Rik, 9430063L05Rik, Usmg4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83679
Homologene: 66961
Or9m1b
Name: olfactory receptor family 9 subfamily M member 1B
Synonyms: GA_x6K02T2Q125-49498697-49497765, MOR173-1, Olfr1160
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258643
Homologene: 74192
Fbln2
Name: fibulin 2
Synonyms: 5730577E14Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14115
HGNC: HGNC:3601
Homologene: 1514
Or13e8
Name: olfactory receptor family 13 subfamily E member 8
Synonyms: mOR6, MOR262-10, GA_x6K02T2N78B-16239704-16240654, Olfr70
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56014
Homologene: 10459
Vmn1r63
Name: vomeronasal 1 receptor 63
Synonyms: V1R1, V1rd1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 81017
Homologene: 41799
Neto1
Name: neuropilin (NRP) and tolloid (TLL)-like 1
Synonyms: C130005O10Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 246317
VEGA: 18
Homologene: 16367
Qrich2
Name: glutamine rich 2
Synonyms: LOC217341
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217341
Homologene: 12951
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Zfp518a
Name: zinc finger protein 518A
Synonyms: 6330417C12Rik, 2810401C22Rik, Zfp518
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72672
VEGA: 19
Homologene: 19378
Nr1d2
Name: nuclear receptor subfamily 1, group D, member 2
Synonyms: Rev-erb beta, RVR
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 353187
HGNC: HGNC:7963
Homologene: 3763
Or5h19
Name: olfactory receptor family 5 subfamily H member 19
Synonyms: GA_x54KRFPKG5P-55265713-55264787, MOR183-8, Olfr187
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258319
Homologene: 133069
Or2n1d
Name: olfactory receptor family 2 subfamily N member 1D
Synonyms: MOR256-7, GA_x6K02T2PSCP-2779375-2780313, Olfr136
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258803
Homologene: 119758
Fndc1
Name: fibronectin type III domain containing 1
Synonyms: 1110027O12Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 68655
Pira13
Name: paired-Ig-like receptor A13
Synonyms: ENSMUSG00000074419, Gm15448
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100041146
Homologene: 134028
Klra9
Name: killer cell lectin-like receptor subfamily A, member 9
Synonyms: Ly49I, LY49I1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16640
Homologene: 110821
Pou2f3
Name: POU domain, class 2, transcription factor 3
Synonyms: Skin, Skn-li, Skn-1a, Skin-1a, Epoc-1, Otf-11, Oct-11a, Otf11, Oct11
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18988
Homologene: 7898
Atp6ap1l
Name: ATPase, H+ transporting, lysosomal accessory protein 1-like
Synonyms: EG435376
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 435376
Homologene: 28130
Skap1
Name: src family associated phosphoprotein 1
Synonyms: Skap-55, 1700091G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78473
Homologene: 2764
Tacr1
Name: tachykinin receptor 1
Synonyms: neurokinin receptor 1, NK-1R, NK1-R, NK1 receptor, Tac1r, substance p receptor, SPr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 21336
Homologene: 20288
Lrrc8b
Name: leucine rich repeat containing 8 family, member B
Synonyms: R75581, 2210408K08Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 433926
Homologene: 9103
Sgsh
Name: N-sulfoglucosamine sulfohydrolase (sulfamidase)
Synonyms: sulphamidase, 4632406A19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 27029
Homologene: 167
Adck5
Name: aarF domain containing kinase 5
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268822
Homologene: 34378
Clba1
Name: clathrin binding box of aftiphilin containing 1
Synonyms: Flj20080, C130001I08Rik, BC022687
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217887
VEGA: 12
Homologene: 17077
Vamp8
Name: vesicle-associated membrane protein 8
Synonyms: endobrevin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22320
Homologene: 37846
Tdrkh
Name: tudor and KH domain containing protein
Synonyms: Tdrd2, 2700091C21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72634
Homologene: 4999
Ciao1
Name: cytosolic iron-sulfur protein assembly 1
Synonyms: Wdr39
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 26371
Homologene: 55850
Spata31d1d
Name: spermatogenesis associated 31 subfamily D, member 1D
Synonyms: 4932411G14Rik, Fam75d1d
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238663
Homologene: 129932
Sowahc
Name: sosondowah ankyrin repeat domain family member C
Synonyms: C820004L04Rik, Ankrd57
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 268301
Homologene: 49723
Igkv1-110
Name: immunoglobulin kappa variable 1-110
Synonyms: Gm16634
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381777
Trav4-2
Name: T cell receptor alpha variable 4-2
Synonyms: Gm13953
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100126462
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 40,543,017 bp
  • T to C, chromosome 1 at 58,017,401 bp
  • A to G, chromosome 2 at 82,980,594 bp
  • C to T, chromosome 2 at 88,006,317 bp
  • A to G, chromosome 2 at 127,246,679 bp
  • T to C, chromosome 2 at 147,049,993 bp
  • A to G, chromosome 2 at 158,009,268 bp
  • T to C, chromosome 3 at 94,429,171 bp
  • A to G, chromosome 3 at 97,710,317 bp
  • A to G, chromosome 3 at 129,737,515 bp
  • T to A, chromosome 4 at 43,697,017 bp
  • T to A, chromosome 4 at 43,938,802 bp
  • A to G, chromosome 4 at 98,497,328 bp
  • A to G, chromosome 4 at 101,611,316 bp
  • T to C, chromosome 5 at 14,775,321 bp
  • T to G, chromosome 5 at 21,522,186 bp
  • T to C, chromosome 5 at 34,217,311 bp
  • C to A, chromosome 5 at 49,960,931 bp
  • T to A, chromosome 5 at 105,481,558 bp
  • C to T, chromosome 5 at 113,723,706 bp
  • G to T, chromosome 6 at 68,270,966 bp
  • A to G, chromosome 6 at 72,388,293 bp
  • A to T, chromosome 6 at 82,557,033 bp
  • A to G, chromosome 6 at 91,263,438 bp
  • A to G, chromosome 6 at 130,182,405 bp
  • A to T, chromosome 7 at 3,822,819 bp
  • G to T, chromosome 7 at 5,803,132 bp
  • A to T, chromosome 7 at 30,533,042 bp
  • G to T, chromosome 7 at 64,268,880 bp
  • T to A, chromosome 7 at 120,090,646 bp
  • A to T, chromosome 7 at 139,680,181 bp
  • A to T, chromosome 8 at 11,006,655 bp
  • C to A, chromosome 9 at 43,199,039 bp
  • C to G, chromosome 9 at 108,611,739 bp
  • T to A, chromosome 9 at 109,732,649 bp
  • T to C, chromosome 9 at 119,941,301 bp
  • A to C, chromosome 10 at 57,523,979 bp
  • G to T, chromosome 10 at 59,221,991 bp
  • A to G, chromosome 11 at 68,790,103 bp
  • T to C, chromosome 11 at 77,741,728 bp
  • A to T, chromosome 11 at 96,754,076 bp
  • C to T, chromosome 11 at 105,867,327 bp
  • GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG to GCTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTGCAACACACCAGGCTGAACTGCACCTGGTTG, chromosome 11 at 116,457,541 bp
  • T to C, chromosome 11 at 119,352,660 bp
  • T to C, chromosome 12 at 24,516,861 bp
  • T to C, chromosome 12 at 44,598,583 bp
  • G to T, chromosome 12 at 80,637,508 bp
  • T to C, chromosome 12 at 112,815,703 bp
  • A to G, chromosome 13 at 49,450,037 bp
  • T to A, chromosome 13 at 51,144,397 bp
  • T to C, chromosome 13 at 59,727,322 bp
  • A to T, chromosome 13 at 74,327,204 bp
  • T to A, chromosome 13 at 76,157,242 bp
  • T to A, chromosome 13 at 90,898,860 bp
  • T to C, chromosome 14 at 18,220,030 bp
  • C to T, chromosome 14 at 32,526,254 bp
  • T to C, chromosome 14 at 44,403,781 bp
  • C to G, chromosome 14 at 53,418,809 bp
  • T to C, chromosome 15 at 76,593,235 bp
  • A to G, chromosome 15 at 101,628,185 bp
  • A to T, chromosome 16 at 17,389,366 bp
  • A to G, chromosome 16 at 59,035,900 bp
  • T to C, chromosome 17 at 7,800,946 bp
  • A to G, chromosome 17 at 23,819,601 bp
  • A to G, chromosome 17 at 31,850,945 bp
  • A to T, chromosome 17 at 34,113,484 bp
  • A to T, chromosome 17 at 38,335,429 bp
  • T to A, chromosome 18 at 20,582,821 bp
  • A to G, chromosome 18 at 52,490,614 bp
  • A to G, chromosome 18 at 86,461,048 bp
  • A to C, chromosome 19 at 40,913,426 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8912 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068765-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.


Title

Text