Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8946Btlr/Mmmh
Stock Number:
068784-MU
Citation ID:
RRID:MMRRC_068784-MU
Other Names:
R8946 (G1)
Major Collection:

Strain Information

Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75786
Homologene: 8844
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Akap12
Name: A kinase anchor protein 12
Synonyms: SSeCKS, Tsga12, Srcs5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83397
VEGA: 10
HGNC: HGNC:370
Homologene: 3740
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Patz1
Name: POZ (BTB) and AT hook containing zinc finger 1
Synonyms: MAZR, 8430401L15Rik, POZ-AT hook-zinc finger protein, Zfp278
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56218
Homologene: 8636
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 32,546,604 bp
  • T to C, chromosome 1 at 58,106,068 bp
  • G to A, chromosome 1 at 88,348,339 bp
  • T to A, chromosome 1 at 93,360,814 bp
  • A to T, chromosome 1 at 162,708,909 bp
  • A to G, chromosome 1 at 193,187,107 bp
  • A to G, chromosome 2 at 52,151,413 bp
  • C to A, chromosome 2 at 54,880,063 bp
  • A to G, chromosome 2 at 91,579,516 bp
  • ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC to ATTTTCAGTTTTC, chromosome 2 at 98,662,324 bp
  • A to T, chromosome 2 at 103,778,033 bp
  • C to T, chromosome 3 at 40,683,359 bp
  • A to G, chromosome 3 at 66,263,880 bp
  • A to G, chromosome 4 at 111,982,001 bp
  • T to C, chromosome 4 at 155,966,425 bp
  • G to A, chromosome 5 at 37,185,740 bp
  • A to G, chromosome 5 at 115,595,345 bp
  • A to T, chromosome 5 at 134,216,319 bp
  • C to G, chromosome 5 at 143,315,040 bp
  • C to T, chromosome 5 at 151,060,802 bp
  • G to A, chromosome 6 at 48,457,137 bp
  • C to T, chromosome 6 at 86,676,244 bp
  • A to T, chromosome 6 at 129,363,986 bp
  • T to C, chromosome 6 at 149,041,987 bp
  • T to C, chromosome 7 at 7,132,470 bp
  • A to G, chromosome 7 at 17,814,074 bp
  • A to T, chromosome 7 at 23,577,215 bp
  • A to G, chromosome 7 at 30,463,200 bp
  • A to G, chromosome 7 at 79,395,978 bp
  • GGC to GGCCACGGCCGC, chromosome 7 at 97,579,906 bp
  • C to A, chromosome 7 at 102,856,518 bp
  • T to C, chromosome 7 at 103,338,366 bp
  • T to A, chromosome 7 at 105,143,625 bp
  • A to G, chromosome 7 at 105,744,317 bp
  • A to T, chromosome 7 at 110,878,140 bp
  • C to A, chromosome 7 at 118,152,677 bp
  • A to C, chromosome 7 at 127,194,751 bp
  • C to A, chromosome 8 at 69,302,381 bp
  • C to T, chromosome 9 at 19,713,589 bp
  • G to A, chromosome 9 at 24,313,229 bp
  • C to T, chromosome 9 at 105,945,634 bp
  • A to G, chromosome 10 at 4,354,368 bp
  • T to A, chromosome 10 at 78,588,849 bp
  • T to C, chromosome 11 at 3,291,856 bp
  • C to A, chromosome 11 at 4,269,225 bp
  • T to A, chromosome 11 at 11,769,485 bp
  • T to C, chromosome 11 at 103,180,915 bp
  • T to A, chromosome 11 at 115,133,912 bp
  • T to C, chromosome 11 at 116,677,632 bp
  • T to G, chromosome 12 at 3,960,298 bp
  • T to C, chromosome 12 at 81,971,384 bp
  • T to C, chromosome 13 at 96,909,529 bp
  • T to A, chromosome 14 at 20,703,317 bp
  • A to T, chromosome 14 at 31,248,149 bp
  • A to G, chromosome 14 at 31,708,126 bp
  • A to T, chromosome 14 at 47,245,295 bp
  • T to C, chromosome 15 at 31,297,748 bp
  • T to C, chromosome 15 at 98,042,901 bp
  • A to C, chromosome 16 at 14,230,716 bp
  • A to G, chromosome 16 at 29,327,783 bp
  • T to C, chromosome 16 at 64,480,304 bp
  • A to G, chromosome 17 at 34,051,783 bp
  • T to C, chromosome 17 at 35,983,587 bp
  • A to T, chromosome 18 at 36,998,493 bp
  • A to T, chromosome 18 at 37,766,658 bp
  • C to A, chromosome 18 at 67,496,616 bp
  • A to T, chromosome 19 at 13,314,138 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8946 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068784-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.