Strain Name:
C57BL/6J-MtgxR8946Btlr/Mmmh
Stock Number:
068784-MU
Citation ID:
RRID:MMRRC_068784-MU
Other Names:
R8946 (G1)
Major Collection:

Strain Information

Nphs1
Name: nephrosis 1, nephrin
Synonyms: nephrin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 54631
HGNC: HGNC:7908
Homologene: 20974
Ckap5
Name: cytoskeleton associated protein 5
Synonyms: 3110043H24Rik, 4930432B04Rik, D730027C18Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75786
Homologene: 8844
Gcn1
Name: GCN1 activator of EIF2AK4
Synonyms: GCN1L, G431004K08Rik, Gcn1l1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231659
HGNC: HGNC:4199
Homologene: 5887
Prrc2c
Name: proline-rich coiled-coil 2C
Synonyms: 9630039I18Rik, 1810043M20Rik, Bat2d, Bat2l2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226562
Homologene: 41015
Akap12
Name: A kinase anchor protein 12
Synonyms: SSeCKS, Tsga12, Srcs5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83397
VEGA: 10
HGNC: HGNC:370
Homologene: 3740
Smg1
Name: SMG1 nonsense mediated mRNA decay associated PI3K related kinase
Synonyms: C130002K18Rik, 5430435M13Rik, 2610207I05Rik, SMG1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233789
Homologene: 56697
Patz1
Name: POZ (BTB) and AT hook containing zinc finger 1
Synonyms: MAZR, 8430401L15Rik, POZ-AT hook-zinc finger protein, Zfp278
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56218
Homologene: 8636
Caprin1
Name: cell cycle associated protein 1
Synonyms: MMGPIP137, Gpiap1, caprin-1, RNG105
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 53872
HGNC: HGNC:6743
Homologene: 4310
Rsf1
Name: remodeling and spacing factor 1
Synonyms: p325, XAP8, Hbxap, C030033M12Rik, 4832420A03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233532
Homologene: 41142
Senp1
Name: SUMO1/sentrin specific peptidase 1
Synonyms: 2310046A20Rik, E330036L07Rik, D15Ertd528e
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223870
Homologene: 8731
Fanci
Name: Fanconi anemia, complementation group I
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 208836
Homologene: 49530
Ankrd28
Name: ankyrin repeat domain 28
Synonyms: E430019N21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105522
VEGA: 14
Homologene: 35374
Ppp1r7
Name: protein phosphatase 1, regulatory subunit 7
Synonyms: SDS22, 2310014J01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 66385
HGNC: HGNC:9295
Homologene: 2032
Ikzf1
Name: IKAROS family zinc finger 1
Synonyms: LyF-1, Ikaros, 5832432G11Rik, Zfpn1a1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 22778
Homologene: 55948
Atp13a5
Name: ATPase type 13A5
Synonyms: C630015F21Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268878
Homologene: 77451
Snrnp27
Name: small nuclear ribonucleoprotein 27 (U4/U6.U5)
Synonyms: 2610209M04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66618
Homologene: 135794
Cd2bp2
Name: CD2 cytoplasmic tail binding protein 2
Synonyms: 2410024K20Rik, 1500011B02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70233
HGNC: HGNC:1656
Homologene: 4455
St6galnac2
Name: ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 2
Synonyms: ST6GalNAc II, Siat7, Siat7b
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20446
Homologene: 4714
Dennd5b
Name: DENN domain containing 5B
Synonyms: 9330160C06Rik, D030011O10Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 320560
Homologene: 44911
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Myh11
Name: myosin, heavy polypeptide 11, smooth muscle
Synonyms: smMHC, SM2, SM1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17880
VEGA: 16
HGNC: HGNC:7569
Homologene: 128512
Intu
Name: inturned planar cell polarity protein
Synonyms: 9430087H23Rik, 9230116I04Rik, Pdzk6, Pdzd6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 380614
Homologene: 41059
Ints15
Name: integrator complex subunit 15
Synonyms: E130309D02Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231868
Homologene: 11445
Neb
Name: nebulin
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 17996
HGNC: HGNC:7720
Homologene: 136285
Syde1
Name: synapse defective 1, Rho GTPase, homolog 1 (C. elegans)
Synonyms: 1200008N06Rik, mSYD1A
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71709
VEGA: 10
Homologene: 13195
Phf7
Name: PHD finger protein 7
Synonyms: 1700010P14Rik, 1700006H01Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71838
VEGA: 14
Homologene: 69217
Gm10801
Name: predicted gene 10801
Type: Gene
Species: Mouse
Chromosome: 2
Jakmip1
Name: janus kinase and microtubule interacting protein 1
Synonyms: Marlin-1, 5830437M04Rik, C330021K24Rik, Gababrbp
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 76071
Homologene: 90789
Ankrd33b
Name: ankyrin repeat domain 33B
Synonyms: 0610012A05Rik, 5730557B15Rik, 3021401C12Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67434
Homologene: 12362
Chchd1
Name: coiled-coil-helix-coiled-coil-helix domain containing 1
Synonyms: 2400010G13Rik, 1110001O19Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66121
VEGA: 14
Homologene: 11923
Aox1
Name: aldehyde oxidase 1
Synonyms: retinal oxidase, Aox-1, Aox-2, Aox2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11761
HGNC: HGNC:553
Homologene: 68165
Npsr1
Name: neuropeptide S receptor 1
Synonyms: PGR14, VRR1, 9330128H10Rik, Gpr154
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319239
Homologene: 45515
Gtf2ird2
Name: GTF2I repeat domain containing 2
Synonyms: 1700012P16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 114674
Homologene: 24941
Fmnl1
Name: formin-like 1
Synonyms: 8030453N10Rik, formin-related gene in leukocytes
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57778
HGNC: HGNC:1212
Homologene: 135620
Trpm8
Name: transient receptor potential cation channel, subfamily M, member 8
Synonyms: CMR1, TRPP8, Trp-p8
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 171382
Homologene: 23433
Col6a5
Name: collagen, type VI, alpha 5
Synonyms: Col6a5, Gm7455
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 665033
Homologene: 122792
Pcnx1
Name: pecanex 1
Synonyms: 3526401J03Rik, 2900024E21Rik, Pcnx
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 54604
VEGA: 12
Homologene: 40997
Sspo
Name: SCO-spondin
Synonyms: C79529, Scospondin
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243369
Homologene: 45453
Semp2l1
Name: SUMO/sentrin specific peptidase 2-like 1
Synonyms: Gm5415
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 408191
Homologene: 130042
Traf3ip3
Name: TRAF3 interacting protein 3
Synonyms: 6030423D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215243
Homologene: 11885
Galnt13
Name: polypeptide N-acetylgalactosaminyltransferase 13
Synonyms: pp-GalNAc-T13
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 271786
Homologene: 62167
Zfp781a
Name: zinc finger protein 781A
Synonyms: D130040H23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211135
Homologene: 138403
Wdhd1
Name: WD repeat and HMG-box DNA binding protein 1
Synonyms: AND-1, D630024B06Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218973
Homologene: 56019
Or56a5
Name: olfactory receptor family 56 subfamily A member 5
Synonyms: GA_x6K02T2PBJ9-7773007-7772066, MOR40-1, Olfr683
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259047
Homologene: 133645
Skint7
Name: selection and upkeep of intraepithelial T cells 7
Synonyms: C130057D23Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 328505
Homologene: 106613
Veph1
Name: ventricular zone expressed PH domain-containing 1
Synonyms: Veph, 2810471M23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72789
Homologene: 11624
Irag1
Name: inositol 1,4,5-triphosphate receptor associated 1
Synonyms: Ris1, Mrvi1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17540
HGNC: HGNC:7237
Homologene: 4425
Or7e166
Name: olfactory receptor family 7 subfamily E member 166
Synonyms: GA_x6K02T2PVTD-13452606-13453535, MOR146-8P, Olfr857
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 257963
Homologene: 134093
Ceacam14
Name: CEA cell adhesion molecule 14
Synonyms: 1600025E09Rik, 1600021E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67084
Homologene: 135962
Spire1
Name: spire type actin nucleation factor 1
Synonyms: Spir-1, 6030430B19Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 68166
VEGA: 18
Homologene: 35507
Clec12a
Name: C-type lectin domain family 12, member a
Synonyms: Micl
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232413
Homologene: 51378
Stard13
Name: StAR related lipid transfer domain containing 13
Synonyms: GT650, DLC2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243362
Homologene: 64844
Zfp773
Name: zinc finger protein 773
Synonyms: 2810409K11Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 76373
Homologene: 137393
Or5b111
Name: olfactory receptor family 5 subfamily B member 111
Synonyms: GA_x6K02T2RE5P-3645346-3644423, MOR202-28, Olfr1465
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258121
HGNC: HGNC:8324
Csnka2ip
Name: casein kinase 2, alpha prime interacting protein
Synonyms: Ckt2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224291
Homologene: 77570
Or52ab4
Name: olfactory receptor family 52 subfamily AB member 4
Synonyms: GA_x6K02T2PBJ9-6047402-6048349, MOR23-1, Olfr599
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258726
Homologene: 27244
Gnl1
Name: guanine nucleotide binding protein-like 1
Synonyms: Gna-rs1, Gnal1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14670
HGNC: HGNC:4413
Homologene: 3862
Lif
Name: leukemia inhibitory factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16878
HGNC: HGNC:6596
Homologene: 1734
Taf10
Name: TATA-box binding protein associated factor 10
Synonyms: TAFII30, Taf2h, 30kDa
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 24075
Homologene: 86923
C1qtnf12
Name: C1q and tumor necrosis factor related 12
Synonyms: 1110035L05Rik, C1qdc2, alipolin, Fam132a, adipolin
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67389
Homologene: 12123
Or51f1
Name: olfactory receptor family 51 subfamily F member 1
Synonyms: GA_x6K02T2PBJ9-5560696-5559746, MOR14-7P, Olfr566
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258168
Homologene: 133721
Vmn1r169
Name: vomeronasal 1 receptor 169
Synonyms: Gm4232
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043103
Homologene: 128341
Pcdha9
Name: protocadherin alpha 9
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 192161
HGNC: HGNC:8664
Homologene: 130700
Cd300lf
Name: CD300 molecule like family member F
Synonyms: Pigr3, CLM-1, IgSF13, IREM1, F730004D16Rik, DIgR2, LMIR3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 246746
Homologene: 51396
Pomc
Name: pro-opiomelanocortin-alpha
Synonyms: POMC, Pomc-1, alpha-MSH, alpha-melanocyte stimulating hormone, adrenal corticotropic hormone, ACTH, gamma-melanocyte stimulating hormone, beta-melanocyte stimulating hormone, gamma-MSH, beta-MSH, alphaMSH, BE, beta-endorphin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18976
VEGA: 12
HGNC: HGNC:9201
Homologene: 723
Pcdhga12
Name: protocadherin gamma subfamily A, 12
Synonyms: pc2c, Pcdh13
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93724
HGNC: HGNC:8699
Homologene: 134588
Ankrd31
Name: ankyrin repeat domain 31
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 625662
Homologene: 110355
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 1 at 32,546,604 bp
  • T to C, chromosome 1 at 58,106,068 bp
  • G to A, chromosome 1 at 88,348,339 bp
  • T to A, chromosome 1 at 93,360,814 bp
  • A to T, chromosome 1 at 162,708,909 bp
  • A to G, chromosome 1 at 193,187,107 bp
  • A to G, chromosome 2 at 52,151,413 bp
  • C to A, chromosome 2 at 54,880,063 bp
  • A to G, chromosome 2 at 91,579,516 bp
  • ATTTTCAGTTTTCTTGCCATATTCCACGTCCTGCACTGGACATTTCTAAATTTTCCACCTTTTTCAGTTTTC to ATTTTCAGTTTTC, chromosome 2 at 98,662,324 bp
  • A to T, chromosome 2 at 103,778,033 bp
  • C to T, chromosome 3 at 40,683,359 bp
  • A to G, chromosome 3 at 66,263,880 bp
  • A to G, chromosome 4 at 111,982,001 bp
  • T to C, chromosome 4 at 155,966,425 bp
  • G to A, chromosome 5 at 37,185,740 bp
  • A to G, chromosome 5 at 115,595,345 bp
  • A to T, chromosome 5 at 134,216,319 bp
  • C to G, chromosome 5 at 143,315,040 bp
  • C to T, chromosome 5 at 151,060,802 bp
  • G to A, chromosome 6 at 48,457,137 bp
  • C to T, chromosome 6 at 86,676,244 bp
  • A to T, chromosome 6 at 129,363,986 bp
  • T to C, chromosome 6 at 149,041,987 bp
  • T to C, chromosome 7 at 7,132,470 bp
  • A to G, chromosome 7 at 17,814,074 bp
  • A to T, chromosome 7 at 23,577,215 bp
  • A to G, chromosome 7 at 30,463,200 bp
  • A to G, chromosome 7 at 79,395,978 bp
  • GGC to GGCCACGGCCGC, chromosome 7 at 97,579,906 bp
  • C to A, chromosome 7 at 102,856,518 bp
  • T to C, chromosome 7 at 103,338,366 bp
  • T to A, chromosome 7 at 105,143,625 bp
  • A to G, chromosome 7 at 105,744,317 bp
  • A to T, chromosome 7 at 110,878,140 bp
  • C to A, chromosome 7 at 118,152,677 bp
  • A to C, chromosome 7 at 127,194,751 bp
  • C to A, chromosome 8 at 69,302,381 bp
  • C to T, chromosome 9 at 19,713,589 bp
  • G to A, chromosome 9 at 24,313,229 bp
  • C to T, chromosome 9 at 105,945,634 bp
  • A to G, chromosome 10 at 4,354,368 bp
  • T to A, chromosome 10 at 78,588,849 bp
  • T to C, chromosome 11 at 3,291,856 bp
  • C to A, chromosome 11 at 4,269,225 bp
  • T to A, chromosome 11 at 11,769,485 bp
  • T to C, chromosome 11 at 103,180,915 bp
  • T to A, chromosome 11 at 115,133,912 bp
  • T to C, chromosome 11 at 116,677,632 bp
  • T to G, chromosome 12 at 3,960,298 bp
  • T to C, chromosome 12 at 81,971,384 bp
  • T to C, chromosome 13 at 96,909,529 bp
  • T to A, chromosome 14 at 20,703,317 bp
  • A to T, chromosome 14 at 31,248,149 bp
  • A to G, chromosome 14 at 31,708,126 bp
  • A to T, chromosome 14 at 47,245,295 bp
  • T to C, chromosome 15 at 31,297,748 bp
  • T to C, chromosome 15 at 98,042,901 bp
  • A to C, chromosome 16 at 14,230,716 bp
  • A to G, chromosome 16 at 29,327,783 bp
  • T to C, chromosome 16 at 64,480,304 bp
  • A to G, chromosome 17 at 34,051,783 bp
  • T to C, chromosome 17 at 35,983,587 bp
  • A to T, chromosome 18 at 36,998,493 bp
  • A to T, chromosome 18 at 37,766,658 bp
  • C to A, chromosome 18 at 67,496,616 bp
  • A to T, chromosome 19 at 13,314,138 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8946 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068784-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.