Strain Name:
C57BL/6J-MtgxR8968Btlr/Mmmh
Stock Number:
068802-MU
Citation ID:
RRID:MMRRC_068802-MU
Other Names:
R8968 (G1)
Major Collection:

Strain Information

Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: 1100001C18Rik, A330076K04Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
B4galt1
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms: beta 1,4-Galactosyltransferase I, b1,4-Galactosyltransferase I, beta-1,4-GalT1, Ggtb2, GalT, Ggtb, B-1,4-GalT1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14595
HGNC: HGNC:924
Homologene: 20378
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Bwf1, Bchs, Alfy, 2610509D04Rik, Ggtb3, D5Ertd66e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Rfc1
Name: replication factor C (activator 1) 1
Synonyms: Recc1, 140kDa, RFC140, Alp145
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19687
HGNC: HGNC:9969
Homologene: 2187
Rrm1
Name: ribonucleotide reductase M1
Synonyms: RnrM1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20133
Homologene: 806
Resf1
Name: retroelement silencing factor 1
Synonyms: 2810474O19Rik, GET
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67246
Homologene: 19251
Snx30
Name: sorting nexin family member 30
Synonyms: 4732481H14Rik, C030041J06Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 209131
Homologene: 2811
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Brpf1
Name: bromodomain and PHD finger containing, 1
Synonyms: 4930540D11Rik, 4833438B11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78783
Homologene: 31251
Cep135
Name: centrosomal protein 135
Synonyms: LOC381644, Cep4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381644
Homologene: 45709
Robo2
Name: roundabout guidance receptor 2
Synonyms: 9430089E08Rik, D230004I22Rik, 2600013A04Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268902
Homologene: 43188
Dsp
Name: desmoplakin
Synonyms: 5730453H04Rik, 2300002E22Rik, DP, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Pole
Name: polymerase (DNA directed), epsilon
Synonyms: pol-epsilon
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18973
HGNC: HGNC:9177
Homologene: 4539
Spg11
Name: SPG11, spatacsin vesicle trafficking associated
Synonyms: 6030465E24Rik, C530005A01Rik, spastic paraplegia 11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 214585
Homologene: 41614
Armt1
Name: acidic residue methyltransferase 1
Synonyms: 1700052N19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73419
Homologene: 41557
Ipmk
Name: inositol polyphosphate multikinase
Synonyms: 2410017C19Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 69718
Homologene: 76214
Setd1a
Name: SET domain containing 1A
Synonyms: KMT2F
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233904
Homologene: 52251
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, 6430706D22Rik, A730008H23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Erh
Name: ERH mRNA splicing and mitosis factor
Synonyms: Prei1, Mer
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 13877
HGNC: HGNC:3447
Homologene: 3274
Cfap97
Name: cilia and flagella associated protein 97
Synonyms: 1110068E21Rik, 4933411K20Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66756
Homologene: 12026
Trap1
Name: TNF receptor-associated protein 1
Synonyms: HSP75, 2410002K23Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 68015
Homologene: 9457
Tusc3
Name: tumor suppressor candidate 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 80286
Homologene: 6937
Slc16a6
Name: solute carrier family 16 (monocarboxylic acid transporters), member 6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 104681
Homologene: 20984
Pigt
Name: phosphatidylinositol glycan anchor biosynthesis, class T
Synonyms: CGI-06, Ndap7, NDAP, 4930534E15Rik, 2510012P17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 78928
Homologene: 6134
Slc4a4
Name: solute carrier family 4 (anion exchanger), member 4
Synonyms: NBC, NBC1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54403
Homologene: 55776
Aqp9
Name: aquaporin 9
Synonyms: 1700020I22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 64008
HGNC: HGNC:643
Homologene: 41405
Wdr72
Name: WD repeat domain 72
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 546144
Homologene: 52326
Slc7a8
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 8
Synonyms: LAT2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50934
VEGA: 14
Homologene: 8166
Myo16
Name: myosin XVI
Synonyms: Nyap3, C230040D10Rik, BM140241
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244281
Homologene: 34710
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Ush2a
Name: usherin
Synonyms: MUSH2A, A930011D15Rik, LOC381317, Ush2a, LOC269160, A930037M10Rik, Ushrn
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 22283
Homologene: 66151
Cpsf1
Name: cleavage and polyadenylation specific factor 1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 94230
VEGA: 15
HGNC: HGNC:2324
Homologene: 40865
Mgam
Name: maltase-glucoamylase
Synonyms: 6030407P20Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232714
HGNC: HGNC:7043
Homologene: 130099
Ttc32
Name: tetratricopeptide repeat domain 32
Synonyms: 1700013G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75516
VEGA: 12
Homologene: 18991
Cyp2c70
Name: cytochrome P450, family 2, subfamily c, polypeptide 70
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226105
Homologene: 120027
Cplane1
Name: ciliogenesis and planar polarity effector 1
Synonyms: 2410089E03Rik, Jbts17, Hug, b2b012Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73692
Homologene: 11315
D930020B18Rik
Name: RIKEN cDNA D930020B18 gene
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216393
Homologene: 87610
Hfm1
Name: HFM1, ATP-dependent DNA helicase homolog
Synonyms: A330009G12Rik, LOC381663, Mer3, Sec63d1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330149
Homologene: 87103
Hc
Name: hemolytic complement
Synonyms: Hfib2, C5, C5a, He
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Vmn2r75
Name: vomeronasal 2, receptor 75
Synonyms: EG546981
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546981
Homologene: 115466
Adamts2
Name: ADAM metallopeptidase with thrombospondin type 1 motif 2
Synonyms: ADAM-TS2, procollagen N-proteinase, hPCPNI, a disintegrin and metalloproteinase with thrombospondin repeats
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216725
HGNC: HGNC:218
Homologene: 8597
Ripk4
Name: receptor-interacting serine-threonine kinase 4
Synonyms: RIP4, ANKK2, Ankrd3, DIk, PKK
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 72388
HGNC: HGNC:496
Homologene: 10772
Selenbp2
Name: selenium binding protein 2
Synonyms: acetaminophen-binding protein, AP56, Lpsb2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 20342
Homologene: 2930
Fmnl1
Name: formin-like 1
Synonyms: 8030453N10Rik, formin-related gene in leukocytes
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 57778
HGNC: HGNC:1212
Homologene: 135620
Dhrs1
Name: dehydrogenase/reductase 1
Synonyms: dehydrogenase/reductase (SDR family) member 1, 1110029G07Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 52585
Homologene: 41696
Ppp4r4
Name: protein phosphatase 4, regulatory subunit 4
Synonyms: 8430415E04Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 74521
Homologene: 12571
Cyp2b23
Name: cytochrome P450, family 2, subfamily b, polypeptide 23
Synonyms: EG243881
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243881
HGNC: HGNC:2615
Homologene: 117483
Ces1d
Name: carboxylesterase 1D
Synonyms: TGH, Ces3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 104158
HGNC: HGNC:1863
Homologene: 35606
Grid2
Name: glutamate receptor, ionotropic, delta 2
Synonyms: B230104L07Rik, GluRdelta2, tpr
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14804
HGNC: HGNC:4576
Homologene: 74399
Zfp518a
Name: zinc finger protein 518A
Synonyms: 6330417C12Rik, 2810401C22Rik, Zfp518
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 72672
VEGA: 19
Homologene: 19378
Tmprss9
Name: transmembrane protease, serine 9
Synonyms: Serase-1B
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 432478
VEGA: 10
Homologene: 115302
Cenpb
Name: centromere protein B
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12616
HGNC: HGNC:1852
Homologene: 1370
Lipo2
Name: lipase, member O2
Synonyms: Gm8981
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 101055671
Homologene: 103863
2210408I21Rik
Name: RIKEN cDNA 2210408I21 gene
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72371
Homologene: 89234
Or4a66
Name: olfactory receptor family 4 subfamily A member 66
Synonyms: MOR225-5, GA_x6K02T2Q125-50181139-50180195, Olfr1196
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258456
Homologene: 123770
Vill
Name: villin-like
Synonyms: Villp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22351
Homologene: 22650
Or2n1d
Name: olfactory receptor family 2 subfamily N member 1D
Synonyms: MOR256-7, Olfr136, GA_x6K02T2PSCP-2779375-2780313
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258803
Homologene: 119758
Vmn2r14
Name: vomeronasal 2, receptor 14
Synonyms: EG231591
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231591
Homologene: 129606
Vmn1r5
Name: vomeronasal 1 receptor 5
Synonyms: V1rc19
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 171192
Homologene: 128340
Hspa1l
Name: heat shock protein 1-like
Synonyms: 70kDa, Msh5, Hsc70t
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15482
HGNC: HGNC:5234
Homologene: 135835
Prps1l1
Name: phosphoribosyl pyrophosphate synthetase 1-like 1
Synonyms: 1700011K15Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 75456
HGNC: HGNC:9463
Homologene: 75282
Or5j3
Name: olfactory receptor family 5 subfamily J member 3
Synonyms: MOR172-1, Olfr1052, GA_x6K02T2Q125-47777498-47778436
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259012
Homologene: 79679
Sel1l2
Name: sel-1 suppressor of lin-12-like 2 (C. elegans)
Synonyms: LOC228684
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228684
Homologene: 16802
Pif1
Name: PIF1 5'-to-3' DNA helicase
Synonyms: AI449441
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208084
Homologene: 99775
Lcn4
Name: lipocalin 4
Synonyms: A630045M08Rik, Vnsp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16821
Homologene: 86960
Redic1
Name: regulator of DNA class I crossover intermediates 1
Synonyms: CN725425, Gm5807
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 545126
Ccdc65
Name: coiled-coil domain containing 65
Synonyms: 4933417K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105833
VEGA: 15
Homologene: 13226
Dmgdh
Name: dimethylglycine dehydrogenase precursor
Synonyms: 1200014D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74129
Homologene: 8372
Vmn2r32
Name: vomeronasal 2, receptor 32
Synonyms: V2r5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 22311
Homologene: 113703
Impa2
Name: inositol monophosphatase 2
Synonyms: inositol (myo)-1(or 4)-monophosphatase 2, 2210415D20Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 114663
VEGA: 18
HGNC: HGNC:6051
Homologene: 22799
Btbd7
Name: BTB domain containing 7
Synonyms: FUP1, 5730507E09Rik, E130118E17Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238386
VEGA: 12
Homologene: 34300
Bmp5
Name: bone morphogenetic protein 5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12160
HGNC: HGNC:1072
Homologene: 22412
Cnga3
Name: cyclic nucleotide gated channel alpha 3
Synonyms: CNG3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 12790
HGNC: HGNC:2150
Homologene: 994
Or52e19b
Name: olfactory receptor family 52 subfamily E member 19B
Synonyms: GA_x6K02T2PBJ9-6092550-6092362, Olfr603, GA_x6K02T2PBJ9-6096387-6095449, Olfr604, MOR32-14_i, MOR32-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259073
Homologene: 121535
Klhl38
Name: kelch-like 38
Synonyms: 8230402K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 268807
Homologene: 18622
Cdk5
Name: cyclin dependent kinase 5
Synonyms: Crk6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12568
HGNC: HGNC:1774
Homologene: 3623
Cdrt4
Name: CMT1A duplicated region transcript 4
Synonyms: 1700019I23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 66338
Homologene: 52147
Pcdha11
Name: protocadherin alpha 11
Synonyms: Crnr7, Cnr7, A830022B16Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 12942
HGNC: HGNC:8665
Homologene: 75095
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 11,110,338 bp
  • T to A, chromosome 1 at 37,261,379 bp
  • CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT to C, chromosome 1 at 88,266,277 bp
  • G to A, chromosome 1 at 188,395,759 bp
  • A to G, chromosome 2 at 26,668,348 bp
  • A to G, chromosome 2 at 35,032,305 bp
  • G to A, chromosome 2 at 86,298,182 bp
  • T to A, chromosome 2 at 88,700,793 bp
  • T to C, chromosome 2 at 122,092,206 bp
  • T to C, chromosome 2 at 131,178,627 bp
  • T to C, chromosome 2 at 140,285,289 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to T, chromosome 3 at 94,700,030 bp
  • T to C, chromosome 4 at 40,807,243 bp
  • T to C, chromosome 4 at 59,886,517 bp
  • T to C, chromosome 4 at 141,470,390 bp
  • T to A, chromosome 5 at 24,422,381 bp
  • C to T, chromosome 5 at 65,275,435 bp
  • T to C, chromosome 5 at 76,606,729 bp
  • A to T, chromosome 5 at 89,084,653 bp
  • C to T, chromosome 5 at 101,864,117 bp
  • T to C, chromosome 5 at 106,917,573 bp
  • T to C, chromosome 5 at 109,217,667 bp
  • T to C, chromosome 5 at 110,312,083 bp
  • A to T, chromosome 6 at 40,757,811 bp
  • A to T, chromosome 6 at 56,986,197 bp
  • T to C, chromosome 6 at 58,890,198 bp
  • A to C, chromosome 6 at 64,666,155 bp
  • T to C, chromosome 6 at 113,322,549 bp
  • T to A, chromosome 6 at 149,327,166 bp
  • G to A, chromosome 7 at 7,474,205 bp
  • G to A, chromosome 7 at 26,679,538 bp
  • A to T, chromosome 7 at 86,171,557 bp
  • C to T, chromosome 7 at 102,468,338 bp
  • A to T, chromosome 7 at 103,383,460 bp
  • C to T, chromosome 7 at 127,786,107 bp
  • T to A, chromosome 8 at 10,569,700 bp
  • T to A, chromosome 8 at 39,130,744 bp
  • T to A, chromosome 8 at 46,170,077 bp
  • A to T, chromosome 8 at 93,187,755 bp
  • CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA to CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA, chromosome 8 at 109,623,788 bp
  • C to T, chromosome 9 at 65,591,794 bp
  • A to T, chromosome 9 at 71,138,203 bp
  • G to A, chromosome 9 at 74,152,447 bp
  • A to T, chromosome 9 at 75,873,297 bp
  • T to C, chromosome 9 at 119,063,603 bp
  • G to T, chromosome 10 at 4,454,150 bp
  • A to T, chromosome 10 at 8,730,415 bp
  • C to T, chromosome 10 at 71,363,503 bp
  • A to T, chromosome 10 at 80,894,329 bp
  • A to C, chromosome 10 at 121,654,816 bp
  • T to C, chromosome 11 at 50,792,723 bp
  • T to A, chromosome 11 at 62,992,808 bp
  • AGGCTCTGG to AGG, chromosome 11 at 103,186,618 bp
  • T to A, chromosome 11 at 105,867,574 bp
  • C to T, chromosome 11 at 109,454,950 bp
  • G to T, chromosome 12 at 9,030,187 bp
  • A to T, chromosome 12 at 34,985,206 bp
  • G to T, chromosome 12 at 80,637,508 bp
  • C to A, chromosome 12 at 102,812,766 bp
  • T to C, chromosome 12 at 103,600,447 bp
  • T to C, chromosome 13 at 38,151,620 bp
  • T to A, chromosome 13 at 77,332,310 bp
  • A to T, chromosome 13 at 93,709,259 bp
  • G to C, chromosome 14 at 54,781,293 bp
  • A to T, chromosome 14 at 55,740,735 bp
  • A to T, chromosome 15 at 8,201,281 bp
  • C to T, chromosome 15 at 58,322,104 bp
  • G to A, chromosome 15 at 76,601,969 bp
  • T to C, chromosome 15 at 91,245,887 bp
  • A to T, chromosome 15 at 98,718,842 bp
  • A to G, chromosome 16 at 4,044,626 bp
  • C to A, chromosome 16 at 73,971,053 bp
  • T to C, chromosome 16 at 97,746,003 bp
  • A to G, chromosome 17 at 34,977,254 bp
  • A to T, chromosome 17 at 38,335,429 bp
  • A to G, chromosome 18 at 37,012,254 bp
  • G to A, chromosome 18 at 67,318,427 bp
  • C to A, chromosome 19 at 33,749,517 bp
  • A to T, chromosome 19 at 40,153,615 bp
  • A to C, chromosome 19 at 40,913,426 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8968 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068802-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.