Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8968Btlr/Mmmh
Stock Number:
068802-MU
Citation ID:
RRID:MMRRC_068802-MU
Other Names:
R8968 (G1)
Major Collection:

Strain Information

Herc3
Name: hect domain and RLD 3
Synonyms: 5730409F18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 73998
HGNC: HGNC:4876
Homologene: 57095
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Sash1
Name: SAM and SH3 domain containing 1
Synonyms: A330076K04Rik, 1100001C18Rik, 2500002E12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70097
Homologene: 69182
B4galt1
Name: UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1
Synonyms: Ggtb, Ggtb2, B-1,4-GalT1, beta-1,4-GalT1, GalT, beta 1,4-Galactosyltransferase I, b1,4-Galactosyltransferase I
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14595
HGNC: HGNC:924
Homologene: 20378
Wdfy3
Name: WD repeat and FYVE domain containing 3
Synonyms: Ggtb3, 2610509D04Rik, D5Ertd66e, Bwf1, Bchs, Alfy
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 72145
Homologene: 22855
Prex2
Name: phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2
Synonyms: 6230420N16Rik, C030045D06Rik, Depdc2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109294
Homologene: 23523
Rfc1
Name: replication factor C (activator 1) 1
Synonyms: RFC140, Alp145, 140kDa, Recc1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19687
HGNC: HGNC:9969
Homologene: 2187
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 11,110,338 bp
  • T to A, chromosome 1 at 37,261,379 bp
  • CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT to C, chromosome 1 at 88,266,277 bp
  • G to A, chromosome 1 at 188,395,759 bp
  • A to G, chromosome 2 at 26,668,348 bp
  • A to G, chromosome 2 at 35,032,305 bp
  • G to A, chromosome 2 at 86,298,182 bp
  • T to A, chromosome 2 at 88,700,793 bp
  • T to C, chromosome 2 at 122,092,206 bp
  • T to C, chromosome 2 at 131,178,627 bp
  • T to C, chromosome 2 at 140,285,289 bp
  • CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT, chromosome 2 at 164,499,669 bp
  • A to T, chromosome 3 at 94,700,030 bp
  • T to C, chromosome 4 at 40,807,243 bp
  • T to C, chromosome 4 at 59,886,517 bp
  • T to C, chromosome 4 at 141,470,390 bp
  • T to A, chromosome 5 at 24,422,381 bp
  • C to T, chromosome 5 at 65,275,435 bp
  • T to C, chromosome 5 at 76,606,729 bp
  • A to T, chromosome 5 at 89,084,653 bp
  • C to T, chromosome 5 at 101,864,117 bp
  • T to C, chromosome 5 at 106,917,573 bp
  • T to C, chromosome 5 at 109,217,667 bp
  • T to C, chromosome 5 at 110,312,083 bp
  • A to T, chromosome 6 at 40,757,811 bp
  • A to T, chromosome 6 at 56,986,197 bp
  • T to C, chromosome 6 at 58,890,198 bp
  • A to C, chromosome 6 at 64,666,155 bp
  • T to C, chromosome 6 at 113,322,549 bp
  • T to A, chromosome 6 at 149,327,166 bp
  • G to A, chromosome 7 at 7,474,205 bp
  • G to A, chromosome 7 at 26,679,538 bp
  • A to T, chromosome 7 at 86,171,557 bp
  • C to T, chromosome 7 at 102,468,338 bp
  • A to T, chromosome 7 at 103,383,460 bp
  • C to T, chromosome 7 at 127,786,107 bp
  • T to A, chromosome 8 at 10,569,700 bp
  • T to A, chromosome 8 at 39,130,744 bp
  • T to A, chromosome 8 at 46,170,077 bp
  • A to T, chromosome 8 at 93,187,755 bp
  • CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA to CCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACACAGGTGACATCAGACACACCTGCATCCAATAGCCCACCACAGGGGACATCAGACACACCTGGATTCAGCAGCCCAACACAGGTGACAACAGCCACACTTGTATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGACACATCTGCATCCATCAGCCCACCACAGGTAATATCAGACACACCTGCATCCAGCAGCCCACCACAGGTGACATCAGAGACACCTGCATCCAGCAGCCCAACA, chromosome 8 at 109,623,788 bp
  • C to T, chromosome 9 at 65,591,794 bp
  • A to T, chromosome 9 at 71,138,203 bp
  • G to A, chromosome 9 at 74,152,447 bp
  • A to T, chromosome 9 at 75,873,297 bp
  • T to C, chromosome 9 at 119,063,603 bp
  • G to T, chromosome 10 at 4,454,150 bp
  • A to T, chromosome 10 at 8,730,415 bp
  • C to T, chromosome 10 at 71,363,503 bp
  • A to T, chromosome 10 at 80,894,329 bp
  • A to C, chromosome 10 at 121,654,816 bp
  • T to C, chromosome 11 at 50,792,723 bp
  • T to A, chromosome 11 at 62,992,808 bp
  • AGGCTCTGG to AGG, chromosome 11 at 103,186,618 bp
  • T to A, chromosome 11 at 105,867,574 bp
  • C to T, chromosome 11 at 109,454,950 bp
  • G to T, chromosome 12 at 9,030,187 bp
  • A to T, chromosome 12 at 34,985,206 bp
  • G to T, chromosome 12 at 80,637,508 bp
  • C to A, chromosome 12 at 102,812,766 bp
  • T to C, chromosome 12 at 103,600,447 bp
  • T to C, chromosome 13 at 38,151,620 bp
  • T to A, chromosome 13 at 77,332,310 bp
  • A to T, chromosome 13 at 93,709,259 bp
  • G to C, chromosome 14 at 54,781,293 bp
  • A to T, chromosome 14 at 55,740,735 bp
  • A to T, chromosome 15 at 8,201,281 bp
  • C to T, chromosome 15 at 58,322,104 bp
  • G to A, chromosome 15 at 76,601,969 bp
  • T to C, chromosome 15 at 91,245,887 bp
  • A to T, chromosome 15 at 98,718,842 bp
  • A to G, chromosome 16 at 4,044,626 bp
  • C to A, chromosome 16 at 73,971,053 bp
  • T to C, chromosome 16 at 97,746,003 bp
  • A to G, chromosome 17 at 34,977,254 bp
  • A to T, chromosome 17 at 38,335,429 bp
  • A to G, chromosome 18 at 37,012,254 bp
  • G to A, chromosome 18 at 67,318,427 bp
  • C to A, chromosome 19 at 33,749,517 bp
  • A to T, chromosome 19 at 40,153,615 bp
  • A to C, chromosome 19 at 40,913,426 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8968 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068802-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.