Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8980Btlr/Mmmh
Stock Number:
068813-MU
Citation ID:
RRID:MMRRC_068813-MU
Other Names:
R8980 (G1)
Major Collection:

Strain Information

Rc3h1
Name: RING CCCH (C3H) domains 1
Synonyms: roquin, 5730557L09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381305
Homologene: 19036
Ano6
Name: anoctamin 6
Synonyms: 2900059G15Rik, F730003B03Rik, Tmem16f
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105722
VEGA: 15
Homologene: 27888
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, 9430078C22Rik, Zfpip
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Cep68
Name: centrosomal protein 68
Synonyms: 6030463E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216543
Homologene: 65235
Prss16
Name: serine protease 16 (thymus)
Synonyms: TSSP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 54373
HGNC: HGNC:9480
Homologene: 38106
Ano10
Name: anoctamin 10
Synonyms: Tmem16k
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102566
VEGA: 9
Homologene: 14314
Clock
Name: clock circadian regulator
Synonyms: 5330400M04Rik, KAT13D, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 118,199,384 bp
  • A to G, chromosome 1 at 160,955,025 bp
  • T to A, chromosome 2 at 128,158,280 bp
  • G to C, chromosome 2 at 153,804,941 bp
  • C to A, chromosome 2 at 181,574,364 bp
  • T to A, chromosome 3 at 64,103,080 bp
  • TACCACCACCACCACCACCACCA to TACCACCACCACCACCACCA, chromosome 4 at 55,009,681 bp
  • T to G, chromosome 4 at 155,832,416 bp
  • T to C, chromosome 5 at 76,254,439 bp
  • T to C, chromosome 5 at 94,218,176 bp
  • T to A, chromosome 5 at 129,660,779 bp
  • C to T, chromosome 6 at 41,613,359 bp
  • A to T, chromosome 6 at 88,000,520 bp
  • C to A, chromosome 7 at 12,991,163 bp
  • A to G, chromosome 7 at 23,865,719 bp
  • A to G, chromosome 7 at 44,468,278 bp
  • A to T, chromosome 8 at 72,373,890 bp
  • T to C, chromosome 8 at 79,076,463 bp
  • A to G, chromosome 8 at 82,990,458 bp
  • G to A, chromosome 8 at 129,219,199 bp
  • A to G, chromosome 9 at 18,988,127 bp
  • G to T, chromosome 9 at 85,732,730 bp
  • T to A, chromosome 9 at 122,261,492 bp
  • T to C, chromosome 10 at 60,337,846 bp
  • T to C, chromosome 10 at 116,283,621 bp
  • A to T, chromosome 11 at 20,240,390 bp
  • A to G, chromosome 12 at 56,770,164 bp
  • T to A, chromosome 12 at 105,780,899 bp
  • T to A, chromosome 13 at 13,185,885 bp
  • C to T, chromosome 13 at 22,003,042 bp
  • A to G, chromosome 13 at 97,194,181 bp
  • A to G, chromosome 15 at 95,967,682 bp
  • C to T, chromosome 15 at 101,892,555 bp
  • G to C, chromosome 16 at 14,461,097 bp
  • A to T, chromosome 17 at 66,555,541 bp
  • C to A, chromosome 18 at 13,846,080 bp
  • A to G, chromosome 18 at 77,246,065 bp
  • A to T, chromosome 19 at 44,993,144 bp
  • A to G, chromosome 19 at 46,322,218 bp
  • T to A, chromosome 19 at 56,355,538 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8980 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068813-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.