Strain Name:
C57BL/6J-MtgxR8980Btlr/Mmmh
Stock Number:
068813-MU
Citation ID:
RRID:MMRRC_068813-MU
Other Names:
R8980 (G1)
Major Collection:

Strain Information

Rc3h1
Name: RING CCCH (C3H) domains 1
Synonyms: 5730557L09Rik, roquin
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381305
Homologene: 19036
Ano6
Name: anoctamin 6
Synonyms: F730003B03Rik, Tmem16f, 2900059G15Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105722
VEGA: 15
Homologene: 27888
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, Zfpip, 9430078C22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Cep68
Name: centrosomal protein 68
Synonyms: 6030463E10Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216543
Homologene: 65235
Prss16
Name: serine protease 16 (thymus)
Synonyms: TSSP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 54373
HGNC: HGNC:9480
Homologene: 38106
Ano10
Name: anoctamin 10
Synonyms: Tmem16k
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102566
VEGA: 9
Homologene: 14314
Clock
Name: clock circadian regulator
Synonyms: KAT13D, 5330400M04Rik, bHLHe8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12753
HGNC: HGNC:2082
Homologene: 3603
Eps15l1
Name: epidermal growth factor receptor pathway substrate 15-like 1
Synonyms: 9830147J04Rik, Eps15-rs, Eps15R
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 13859
Homologene: 31881
Rab7
Name: RAB7, member RAS oncogene family
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19349
HGNC: HGNC:9788
Homologene: 3408
Ak7
Name: adenylate kinase 7
Synonyms: 4930502N02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 78801
VEGA: 12
Homologene: 14268
St8sia5
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 5
Synonyms: Siat8e, ST8SiaV
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225742
Homologene: 8331
Bcl2l11
Name: BCL2 like 11
Synonyms: Bod, Bim, 1500006F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12125
HGNC: HGNC:994
Homologene: 7643
Ibtk
Name: inhibitor of Bruton agammaglobulinemia tyrosine kinase
Synonyms: 5430411K16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108837
Homologene: 34661
Cdh23
Name: cadherin related 23 (otocadherin)
Synonyms: nmf181, 4930542A03Rik, nmf112, bob, nmf252, mdfw, USH1D, sals, ahl
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 22295
Homologene: 11142
Psd
Name: pleckstrin and Sec7 domain containing
Synonyms: Efa6, Efa6a, Psdl, 1110007H17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73728
VEGA: 19
HGNC: HGNC:9507
Homologene: 31115
Uckl1
Name: uridine-cytidine kinase 1-like 1
Synonyms: 1110007H10Rik, Urkl1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68556
Homologene: 101414
Ephb6
Name: Eph receptor B6
Synonyms: Mep, Cekl
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13848
HGNC: HGNC:3396
Homologene: 20940
Vmn2r1
Name: vomeronasal 2, receptor 1
Synonyms: V2r83, EG56544
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 56544
Homologene: 84832
Krt76
Name: keratin 76
Synonyms: 2310001L23Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 77055
Homologene: 22931
Zfp521
Name: zinc finger protein 521
Synonyms: B930086A16Rik, Evi3
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225207
VEGA: 18
Homologene: 9151
Nrap
Name: nebulin-related anchoring protein
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 18175
HGNC: HGNC:7988
Homologene: 4499
Prl2c5
Name: prolactin family 2, subfamily c, member 5
Synonyms: PLF-4, Mrpplf4, MRP-4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107849
Homologene: 40763
Zfp11
Name: zinc finger protein 11
Synonyms: Zfp-11, Krox-6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22648
Homologene: 87241
Slc25a21
Name: solute carrier family 25 (mitochondrial oxodicarboxylate carrier), member 21
Synonyms: 9930033G19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217593
Homologene: 6988
Ptprb
Name: protein tyrosine phosphatase receptor type B
Synonyms: VE-PTP, 3230402H02Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19263
VEGA: 10
HGNC: HGNC:9665
Homologene: 2125
Abcc1
Name: ATP-binding cassette, sub-family C member 1
Synonyms: MRP, Abcc1a, Abcc1b, Mdrap, Mrp1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17250
HGNC: HGNC:51
Homologene: 133779
Hexb
Name: hexosaminidase B
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15212
VEGA: 13
HGNC: HGNC:4879
Homologene: 437
Themis3
Name: thymocyte selection associated family member 3
Synonyms: 9130404H23Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74556
Homologene: 137389
Vmn1r177
Name: vomeronasal 1 receptor 177
Synonyms: V1rd12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 384572
Homologene: 122945
Or7g12
Name: olfactory receptor family 7 subfamily G member 12
Synonyms: MOR153-2, GA_x6K02T2PVTD-12724921-12725859, MOR153-4_p, Olfr834
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258074
HGNC: HGNC:8467
Homologene: 128143
Zfp827
Name: zinc finger protein 827
Synonyms: 2810449M09Rik, D630040G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 622675
Homologene: 45622
Rnf150
Name: ring finger protein 150
Synonyms: A630007N06Rik, C030044C12Rik, Greul5
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330812
Homologene: 33783
Sema4g
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4G
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 26456
Homologene: 22682
Josd2
Name: Josephin domain containing 2
Synonyms: 1110007C05Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 66124
Homologene: 26696
Slc27a5
Name: solute carrier family 27 (fatty acid transporter), member 5
Synonyms: VLCS-H2, VLCSH2, FACVL3, FATP5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26459
Homologene: 7596
Efcab8
Name: EF-hand calcium binding domain 8
Synonyms: EG329541
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100504221
Aurkaip1
Name: aurora kinase A interacting protein 1
Synonyms: Aurora-A kinase interacting protein, AIP, 0610033H09Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66077
Homologene: 11916
Gm29106
Name: predicted gene 29106
Type: Gene
Species: Mouse
Chromosome: 1
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • G to A, chromosome 1 at 118,199,384 bp
  • A to G, chromosome 1 at 160,955,025 bp
  • T to A, chromosome 2 at 128,158,280 bp
  • G to C, chromosome 2 at 153,804,941 bp
  • C to A, chromosome 2 at 181,574,364 bp
  • T to A, chromosome 3 at 64,103,080 bp
  • TACCACCACCACCACCACCACCA to TACCACCACCACCACCACCA, chromosome 4 at 55,009,681 bp
  • T to G, chromosome 4 at 155,832,416 bp
  • T to C, chromosome 5 at 76,254,439 bp
  • T to C, chromosome 5 at 94,218,176 bp
  • T to A, chromosome 5 at 129,660,779 bp
  • C to T, chromosome 6 at 41,613,359 bp
  • A to T, chromosome 6 at 88,000,520 bp
  • C to A, chromosome 7 at 12,991,163 bp
  • A to G, chromosome 7 at 23,865,719 bp
  • A to G, chromosome 7 at 44,468,278 bp
  • A to T, chromosome 8 at 72,373,890 bp
  • T to C, chromosome 8 at 79,076,463 bp
  • A to G, chromosome 8 at 82,990,458 bp
  • G to A, chromosome 8 at 129,219,199 bp
  • A to G, chromosome 9 at 18,988,127 bp
  • G to T, chromosome 9 at 85,732,730 bp
  • T to A, chromosome 9 at 122,261,492 bp
  • T to C, chromosome 10 at 60,337,846 bp
  • T to C, chromosome 10 at 116,283,621 bp
  • A to T, chromosome 11 at 20,240,390 bp
  • A to G, chromosome 12 at 56,770,164 bp
  • T to A, chromosome 12 at 105,780,899 bp
  • T to A, chromosome 13 at 13,185,885 bp
  • C to T, chromosome 13 at 22,003,042 bp
  • A to G, chromosome 13 at 97,194,181 bp
  • A to G, chromosome 15 at 95,967,682 bp
  • C to T, chromosome 15 at 101,892,555 bp
  • G to C, chromosome 16 at 14,461,097 bp
  • A to T, chromosome 17 at 66,555,541 bp
  • C to A, chromosome 18 at 13,846,080 bp
  • A to G, chromosome 18 at 77,246,065 bp
  • A to T, chromosome 19 at 44,993,144 bp
  • A to G, chromosome 19 at 46,322,218 bp
  • T to A, chromosome 19 at 56,355,538 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8980 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068813-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.