Strain Name:
C57BL/6J-MtgxR8988Btlr/Mmmh
Stock Number:
068820-MU
Citation ID:
RRID:MMRRC_068820-MU
Other Names:
R8988 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: Rxrip13, A230020K14Rik, N-CoR, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Dlc1
Name: deleted in liver cancer 1
Synonyms: Arhgap7, STARD12, p122-RhoGAP, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Khdc4
Name: KH domain containing 4, pre-mRNA splicing factor
Synonyms: 2810403A07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74200
Homologene: 41761
Slk
Name: STE20-like kinase
Synonyms: Etk4, Stk2, mSLK, SLK, 9A2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: Smc2l1, CAP-E, 5730502P04Rik, Fin16
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14211
Homologene: 4705
Uba2
Name: ubiquitin-like modifier activating enzyme 2
Synonyms: Uble1b, SAE2, Arx, anthracycline-associated resistance, UBA2, Sumo-1 activating enzyme subunit 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50995
Homologene: 4018
Apbb2
Name: amyloid beta precursor protein binding family B member 2
Synonyms: Zfra, Rirl1, FE65L1, 2310007D03Rik, TR2L
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11787
HGNC: HGNC:582
Homologene: 32079
Pcnt
Name: pericentrin (kendrin)
Synonyms: m239Asp, m275Asp, Pcnt2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18541
VEGA: 10
Sulf1
Name: sulfatase 1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240725
Homologene: 49408
Helz
Name: helicase with zinc finger domain
Synonyms: 3110078M01Rik, 9630002H22Rik, 9430093I07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78455
Homologene: 8918
Tex2
Name: testis expressed gene 2
Synonyms: Taz4, 4930568E07Rik, Def-5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21763
Homologene: 32414
Wapl
Name: WAPL cohesin release factor
Synonyms: Wapal, A530089A20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 218914
Homologene: 41002
Map3k11
Name: mitogen-activated protein kinase kinase kinase 11
Synonyms: Mlk3, 2610017K16Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 26403
VEGA: 19
HGNC: HGNC:6850
Homologene: 37618
Parn
Name: poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms: DAN, 1200003I18Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74108
VEGA: 16
HGNC: HGNC:8609
Homologene: 31098
Abi2
Name: abl interactor 2
Synonyms: 8430425M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329165
Homologene: 4209
Epha8
Name: Eph receptor A8
Synonyms: Eek, EphA8, Hek3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13842
HGNC: HGNC:3391
Homologene: 22436
Atg2b
Name: autophagy related 2B
Synonyms: C030004M05Rik, 2410024A21Rik, C630028L02Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 76559
VEGA: 12
Homologene: 9974
Trp53bp2
Name: transformation related protein 53 binding protein 2
Synonyms: ASPP2, 53BP2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 209456
Homologene: 3959
Reep3
Name: receptor accessory protein 3
Synonyms: D10Ucla1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 28193
VEGA: 10
Homologene: 37401
Mib2
Name: mindbomb E3 ubiquitin protein ligase 2
Synonyms: Zzank1, 2210008I11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76580
Homologene: 16062
Fbxo9
Name: f-box protein 9
Synonyms: 9030401P18Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 71538
Homologene: 8217
Eef1d
Name: eukaryotic translation elongation factor 1 delta
Synonyms: 1700026P12Rik, 5730529A16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 66656
HGNC: HGNC:3211
Homologene: 23404
Nrip1
Name: nuclear receptor interacting protein 1
Synonyms: 8430438I05Rik, 6030458L20Rik, RIP140
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 268903
HGNC: HGNC:8001
Homologene: 2606
Erbb3
Name: erb-b2 receptor tyrosine kinase 3
Synonyms: Erbb3r, HER3, Erbb-3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13867
HGNC: HGNC:3431
Homologene: 20457
Dync2h1
Name: dynein cytoplasmic 2 heavy chain 1
Synonyms: DHC1b, m152Asp, b2b414Clo, D030010H02Rik, D330044F14Rik, Dnchc2, DHC2, 4432416O06Rik, m407Asp
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 110350
HGNC: HGNC:2962
Homologene: 14468
Mtr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase
Synonyms: methionine synthase, MS, D830038K18Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238505
VEGA: 13
HGNC: HGNC:7468
Homologene: 37280
Pnpla6
Name: patatin-like phospholipase domain containing 6
Synonyms: Swiss-cheese, MSws, Nte
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50767
Homologene: 21333
Zfp979
Name: zinc finger protein 979
Synonyms: 2610305D13Rik, Ssm1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 112422
Homologene: 133076
Tmem184b
Name: transmembrane protein 184b
Synonyms: 4732495E13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223693
VEGA: 15
HGNC: HGNC:1310
Homologene: 6396
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Bhlhe40
Name: basic helix-loop-helix family, member e40
Synonyms: eip1 (E47 interaction protein 1), Sharp2, DEC1, Bhlhb2, Clast5, CR8, cytokine response gene 8, Stra13, Stra14, C130042M06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 20893
HGNC: HGNC:1046
Homologene: 2722
Peg10
Name: paternally expressed 10
Synonyms: MyEF-3, MEF3L, Mart2, Edr, Mar2, MyEF-3 like, HB-1, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Stat5a
Name: signal transducer and activator of transcription 5A
Synonyms: STAT5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20850
Homologene: 20680
Reln
Name: reelin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19699
HGNC: HGNC:9957
Homologene: 3699
Fbn1
Name: fibrillin 1
Synonyms: Fib-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14118
HGNC: HGNC:3603
Homologene: 30958
Nell1
Name: NEL-like 1
Synonyms: B230343H07Rik, l7R6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338352
HGNC: HGNC:7750
Homologene: 4486
P3h3
Name: prolyl 3-hydroxylase 3
Synonyms: Leprel2, Grcb
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14789
Homologene: 8401
Slc4a3
Name: solute carrier family 4 (anion exchanger), member 3
Synonyms: A930038D23Rik, Ae3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20536
Homologene: 129474
Ephb2
Name: Eph receptor B2
Synonyms: Prkm5, Erk, eteck, Tyro5, Nuk, Cek5, Qek5, Sek3, Hek5, Drt
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13844
HGNC: HGNC:3393
Homologene: 37925
Pkdrej
Name: polycystin (PKD) family receptor for egg jelly
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18766
VEGA: 15
HGNC: HGNC:9015
Homologene: 4427
Gm11639
Name: predicted gene 11639
Synonyms: Gm11639, Efcab15
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 105242472
Zfp790
Name: zinc finger protein 790
Synonyms: 6330581L23Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233056
Homologene: 51695
Dll3
Name: delta like canonical Notch ligand 3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13389
HGNC: HGNC:2909
Homologene: 7291
Zan
Name: zonadhesin
Synonyms: Zan
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22635
Homologene: 124417
Or6d14
Name: olfactory receptor family 6 subfamily D member 14
Synonyms: GA_x54KRFPKN04-58190962-58191900, Olfr214, MOR119-1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258754
Homologene: 133694
Otog
Name: otogelin
Synonyms: Otgn
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18419
HGNC: HGNC:8516
Homologene: 8421
Cyp2b10
Name: cytochrome P450, family 2, subfamily b, polypeptide 10
Synonyms: phenobarbitol inducible, type b, Cyp2b, p16, Cyp2b20
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13088
HGNC: HGNC:2615
Homologene: 73894
Trmt11
Name: tRNA methyltransferase 11
Synonyms: 3110045I18Rik, 2410075D05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 73681
VEGA: 10
Homologene: 6876
Aox1
Name: aldehyde oxidase 1
Synonyms: Aox2, Aox-1, retinal oxidase, Aox-2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 11761
HGNC: HGNC:553
Homologene: 68165
Ttc41
Name: tetratricopeptide repeat domain 41
Synonyms: Gnn, BC030307
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 103220
VEGA: 10
Homologene: 52968
Krt18
Name: keratin 18
Synonyms: Endo B, K18, Krt1-18, CK18
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16668
VEGA: 15
HGNC: HGNC:6430
Homologene: 55448
Sel1l3
Name: sel-1 suppressor of lin-12-like 3 (C. elegans)
Synonyms: 2310045A20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231238
Homologene: 9054
Il18
Name: interleukin 18
Synonyms: Igif, Il-18
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16173
VEGA: 9
HGNC: HGNC:5986
Homologene: 1200
Mical2
Name: microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms: 5330438E18Rik, Ebitein1, 4921517J23Rik, Micalcl
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320878
Homologene: 8760
Lmntd2
Name: lamin tail domain containing 2
Synonyms: 1600016N20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72000
Homologene: 104159
Prickle2
Name: prickle planar cell polarity protein 2
Synonyms: 6230400G14Rik, mpk2, Pk2, 6720451F06Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243548
Homologene: 17889
Kcnh7
Name: potassium voltage-gated channel, subfamily H (eag-related), member 7
Synonyms: Kv11.3, erg3, 9330137I11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 170738
Homologene: 13249
Psg21
Name: pregnancy-specific beta-1-glycoprotein 21
Synonyms: 1600019C01Rik, cea8, 1600026N13Rik, 1600025N01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72242
Homologene: 110989
Or2y12
Name: olfactory receptor family 2 subfamily Y member 12
Synonyms: MOR256-43P, Olfr1382, MOR256-57, GA_x6K02T2QP88-5901165-5900230
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 257971
Slc26a4
Name: solute carrier family 26, member 4
Synonyms: Pds, pendrin
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 23985
VEGA: 12
HGNC: HGNC:8818
Homologene: 20132
Slc9b1
Name: solute carrier family 9, subfamily B (NHA1, cation proton antiporter 1), member 1
Synonyms: Nhedc1, 1700094G20Rik, 4933424B12Rik, 4933425K02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74446
Homologene: 49914
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Nek4
Name: NIMA (never in mitosis gene a)-related expressed kinase 4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 23955
VEGA: 14
Homologene: 2376
Or13a19
Name: olfactory receptor family 13 subfamily A member 19
Synonyms: Olfr525, GA_x6K02T2PBJ9-42472898-42473827, MOR251-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258958
Homologene: 138321
Zfp618
Name: zinc finger protein 618
Synonyms: 2810040O04Rik, Nedd10, D430033D05Rik, 2810031P15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72701
Homologene: 18975
Serpinb6b
Name: serine (or cysteine) peptidase inhibitor, clade B, member 6b
Synonyms: ovalbumin, Spi12, NK13
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20708
HGNC: HGNC:8950
Homologene: 22633
Or6c69c
Name: olfactory receptor family 6 subfamily C member 69C
Synonyms: GA_x6K02T2PULF-11745102-11746040, MOR113-2, Olfr822
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258666
Homologene: 133890
Ggt1
Name: gamma-glutamyltransferase 1
Synonyms: dwg, CD224, Ggtp, GGT
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14598
Homologene: 68450
Tcp11l1
Name: t-complex 11 like 1
Synonyms: C130096D04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320554
Homologene: 41260
Musk
Name: muscle, skeletal, receptor tyrosine kinase
Synonyms: Nsk3, Nsk2, MDK4, Nsk1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 18198
HGNC: HGNC:7525
Homologene: 4084
Krt1
Name: keratin 1
Synonyms: Krt-2.1, Krt2-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16678
VEGA: 15
HGNC: HGNC:6412
Homologene: 38146
Rps6ka4
Name: ribosomal protein S6 kinase, polypeptide 4
Synonyms: 90kDa, MSK2, 1110069D02Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 56613
VEGA: 19
Homologene: 69288
Cd200l1
Name: CD200 molecule like 1
Synonyms: LOC208166, Gm609, LOC385647, iSEC1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208166
Homologene: 86707
Or6c208
Name: olfactory receptor family 6 subfamily C member 208
Synonyms: Olfr784, MOR110-3, GA_x6K02T2PULF-11068246-11069205
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258724
Homologene: 138306
Arf3
Name: ADP-ribosylation factor 3
Synonyms: 5430400P17Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 11842
HGNC: HGNC:654
Homologene: 68195
Grin2d
Name: glutamate receptor, ionotropic, NMDA2D (epsilon 4)
Synonyms: NMDAR2D, NR2D, GluRepsilon4, GluN2D
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 14814
HGNC: HGNC:4588
Homologene: 648
Or2a5
Name: olfactory receptor family 2 subfamily A member 5
Synonyms: Olfr448, GA_x6K02T2P3E9-4663051-4662119, MOR261-13
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 258270
HGNC: HGNC:8232
Homologene: 64846
Ighv2-6-8
Name: immunoglobulin heavy variable 2-6-8
Synonyms: Gm16887
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 791090
Wfdc9
Name: WAP four-disulfide core domain 9
Synonyms: OTTMUSG00000001088
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 629754
Homologene: 77391
Pigb
Name: phosphatidylinositol glycan anchor biosynthesis, class B
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 55981
HGNC: HGNC:8959
Homologene: 3570
Lrrc26
Name: leucine rich repeat containing 26
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 227618
Homologene: 16228
Igkv9-129
Name: immunoglobulin kappa variable 9-129
Synonyms: immunoglobulin kappa light chain
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 692182
Nicn1
Name: nicolin 1
Synonyms: 1500032A17Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66257
Homologene: 11936
Gm45861
Name: predicted gene 45861
Type: Gene
Species: Mouse
Chromosome: 8
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 12,836,275 bp
  • A to C, chromosome 1 at 58,049,466 bp
  • C to T, chromosome 1 at 60,450,092 bp
  • T to G, chromosome 1 at 75,551,313 bp
  • T to A, chromosome 1 at 140,428,849 bp
  • A to G, chromosome 1 at 182,440,868 bp
  • G to T, chromosome 2 at 25,290,274 bp
  • T to A, chromosome 2 at 62,721,865 bp
  • T to A, chromosome 2 at 104,706,508 bp
  • C to T, chromosome 2 at 125,370,806 bp
  • C to A, chromosome 2 at 156,521,671 bp
  • T to A, chromosome 2 at 164,651,751 bp
  • A to G, chromosome 3 at 88,699,979 bp
  • A to T, chromosome 3 at 135,373,139 bp
  • T to A, chromosome 4 at 52,475,100 bp
  • T to C, chromosome 4 at 58,354,032 bp
  • A to T, chromosome 4 at 63,094,471 bp
  • C to A, chromosome 4 at 136,675,458 bp
  • G to T, chromosome 4 at 136,938,586 bp
  • A to C, chromosome 4 at 147,613,527 bp
  • G to A, chromosome 4 at 155,656,272 bp
  • T to C, chromosome 5 at 21,899,157 bp
  • T to C, chromosome 5 at 53,123,429 bp
  • T to C, chromosome 5 at 66,452,101 bp
  • T to A, chromosome 5 at 121,277,756 bp
  • C to T, chromosome 5 at 137,408,301 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to A, chromosome 6 at 42,897,267 bp
  • T to A, chromosome 6 at 67,840,122 bp
  • T to C, chromosome 6 at 92,458,639 bp
  • C to T, chromosome 6 at 108,662,557 bp
  • A to G, chromosome 6 at 116,557,294 bp
  • C to A, chromosome 6 at 124,857,601 bp
  • A to G, chromosome 7 at 18,652,464 bp
  • G to A, chromosome 7 at 25,926,245 bp
  • A to T, chromosome 7 at 28,296,368 bp
  • A to G, chromosome 7 at 29,828,168 bp
  • A to C, chromosome 7 at 34,154,562 bp
  • A to T, chromosome 7 at 45,834,001 bp
  • A to G, chromosome 7 at 46,310,147 bp
  • C to T, chromosome 7 at 50,560,795 bp
  • A to C, chromosome 7 at 112,311,454 bp
  • G to A, chromosome 7 at 140,323,025 bp
  • A to T, chromosome 7 at 141,212,064 bp
  • G to T, chromosome 8 at 3,517,401 bp
  • T to C, chromosome 8 at 27,542,503 bp
  • C to T, chromosome 8 at 36,572,843 bp
  • A to G, chromosome 9 at 7,037,727 bp
  • A to T, chromosome 9 at 50,577,878 bp
  • A to G, chromosome 9 at 73,022,294 bp
  • G to A, chromosome 9 at 78,084,651 bp
  • C to T, chromosome 9 at 108,294,509 bp
  • A to G, chromosome 10 at 30,591,031 bp
  • T to C, chromosome 10 at 67,036,007 bp
  • T to G, chromosome 10 at 75,576,222 bp
  • C to A, chromosome 10 at 76,409,573 bp
  • T to A, chromosome 10 at 86,713,735 bp
  • T to C, chromosome 10 at 128,570,161 bp
  • T to C, chromosome 10 at 129,388,371 bp
  • T to A, chromosome 10 at 130,074,653 bp
  • C to A, chromosome 11 at 49,535,201 bp
  • G to A, chromosome 11 at 62,343,045 bp
  • A to T, chromosome 11 at 100,883,938 bp
  • T to G, chromosome 11 at 105,020,526 bp
  • A to T, chromosome 11 at 106,511,905 bp
  • T to A, chromosome 11 at 107,604,253 bp
  • A to G, chromosome 12 at 31,522,524 bp
  • T to A, chromosome 12 at 105,617,129 bp
  • A to G, chromosome 12 at 113,796,360 bp
  • A to T, chromosome 13 at 12,235,479 bp
  • C to A, chromosome 13 at 32,978,142 bp
  • T to C, chromosome 14 at 30,963,967 bp
  • T to A, chromosome 14 at 34,729,182 bp
  • A to G, chromosome 15 at 75,896,311 bp
  • A to G, chromosome 15 at 79,377,064 bp
  • A to T, chromosome 15 at 85,816,337 bp
  • A to T, chromosome 15 at 98,741,052 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • C to G, chromosome 15 at 102,029,527 bp
  • A to G, chromosome 16 at 13,648,417 bp
  • T to C, chromosome 16 at 45,417,908 bp
  • T to C, chromosome 16 at 76,292,014 bp
  • A to T, chromosome 19 at 5,702,138 bp
  • A to G, chromosome 19 at 6,831,299 bp
  • A to G, chromosome 19 at 47,620,273 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8988 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068820-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.