Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR8988Btlr/Mmmh
Stock Number:
068820-MU
Citation ID:
RRID:MMRRC_068820-MU
Other Names:
R8988 (G1)
Major Collection:

Strain Information

Ncor1
Name: nuclear receptor co-repressor 1
Synonyms: N-CoR, Rxrip13, A230020K14Rik, 5730405M06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20185
HGNC: HGNC:7672
Homologene: 38166
Epb41l1
Name: erythrocyte membrane protein band 4.1 like 1
Synonyms: 4.1N, Epb4.1l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 13821
HGNC: HGNC:3378
Homologene: 8126
Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Khdc4
Name: KH domain containing 4, pre-mRNA splicing factor
Synonyms: 2810403A07Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74200
Homologene: 41761
Slk
Name: STE20-like kinase
Synonyms: 9A2, mSLK, Etk4, SLK, Stk2
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 20874
Homologene: 22515
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: 5730502P04Rik, CAP-E, Fin16, Smc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14211
Homologene: 4705
Uba2
Name: ubiquitin-like modifier activating enzyme 2
Synonyms: Sumo-1 activating enzyme subunit 2, UBA2, anthracycline-associated resistance, Arx, SAE2, Uble1b
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 50995
Homologene: 4018
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 12,836,275 bp
  • A to C, chromosome 1 at 58,049,466 bp
  • C to T, chromosome 1 at 60,450,092 bp
  • T to G, chromosome 1 at 75,551,313 bp
  • T to A, chromosome 1 at 140,428,849 bp
  • A to G, chromosome 1 at 182,440,868 bp
  • G to T, chromosome 2 at 25,290,274 bp
  • T to A, chromosome 2 at 62,721,865 bp
  • T to A, chromosome 2 at 104,706,508 bp
  • C to T, chromosome 2 at 125,370,806 bp
  • C to A, chromosome 2 at 156,521,671 bp
  • T to A, chromosome 2 at 164,651,751 bp
  • A to G, chromosome 3 at 88,699,979 bp
  • A to T, chromosome 3 at 135,373,139 bp
  • T to A, chromosome 4 at 52,475,100 bp
  • T to C, chromosome 4 at 58,354,032 bp
  • A to T, chromosome 4 at 63,094,471 bp
  • C to A, chromosome 4 at 136,675,458 bp
  • G to T, chromosome 4 at 136,938,586 bp
  • A to C, chromosome 4 at 147,613,527 bp
  • G to A, chromosome 4 at 155,656,272 bp
  • T to C, chromosome 5 at 21,899,157 bp
  • T to C, chromosome 5 at 53,123,429 bp
  • T to C, chromosome 5 at 66,452,101 bp
  • T to A, chromosome 5 at 121,277,756 bp
  • C to T, chromosome 5 at 137,408,301 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to A, chromosome 6 at 42,897,267 bp
  • T to A, chromosome 6 at 67,840,122 bp
  • T to C, chromosome 6 at 92,458,639 bp
  • C to T, chromosome 6 at 108,662,557 bp
  • A to G, chromosome 6 at 116,557,294 bp
  • C to A, chromosome 6 at 124,857,601 bp
  • A to G, chromosome 7 at 18,652,464 bp
  • G to A, chromosome 7 at 25,926,245 bp
  • A to T, chromosome 7 at 28,296,368 bp
  • A to G, chromosome 7 at 29,828,168 bp
  • A to C, chromosome 7 at 34,154,562 bp
  • A to T, chromosome 7 at 45,834,001 bp
  • A to G, chromosome 7 at 46,310,147 bp
  • C to T, chromosome 7 at 50,560,795 bp
  • A to C, chromosome 7 at 112,311,454 bp
  • G to A, chromosome 7 at 140,323,025 bp
  • A to T, chromosome 7 at 141,212,064 bp
  • G to T, chromosome 8 at 3,517,401 bp
  • T to C, chromosome 8 at 27,542,503 bp
  • C to T, chromosome 8 at 36,572,843 bp
  • A to G, chromosome 9 at 7,037,727 bp
  • A to T, chromosome 9 at 50,577,878 bp
  • A to G, chromosome 9 at 73,022,294 bp
  • G to A, chromosome 9 at 78,084,651 bp
  • C to T, chromosome 9 at 108,294,509 bp
  • A to G, chromosome 10 at 30,591,031 bp
  • T to C, chromosome 10 at 67,036,007 bp
  • T to G, chromosome 10 at 75,576,222 bp
  • C to A, chromosome 10 at 76,409,573 bp
  • T to A, chromosome 10 at 86,713,735 bp
  • T to C, chromosome 10 at 128,570,161 bp
  • T to C, chromosome 10 at 129,388,371 bp
  • T to A, chromosome 10 at 130,074,653 bp
  • C to A, chromosome 11 at 49,535,201 bp
  • G to A, chromosome 11 at 62,343,045 bp
  • A to T, chromosome 11 at 100,883,938 bp
  • T to G, chromosome 11 at 105,020,526 bp
  • A to T, chromosome 11 at 106,511,905 bp
  • T to A, chromosome 11 at 107,604,253 bp
  • A to G, chromosome 12 at 31,522,524 bp
  • T to A, chromosome 12 at 105,617,129 bp
  • A to G, chromosome 12 at 113,796,360 bp
  • A to T, chromosome 13 at 12,235,479 bp
  • C to A, chromosome 13 at 32,978,142 bp
  • T to C, chromosome 14 at 30,963,967 bp
  • T to A, chromosome 14 at 34,729,182 bp
  • A to G, chromosome 15 at 75,896,311 bp
  • A to G, chromosome 15 at 79,377,064 bp
  • A to T, chromosome 15 at 85,816,337 bp
  • A to T, chromosome 15 at 98,741,052 bp
  • AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC to AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC, chromosome 15 at 101,850,378 bp
  • C to G, chromosome 15 at 102,029,527 bp
  • A to G, chromosome 16 at 13,648,417 bp
  • T to C, chromosome 16 at 45,417,908 bp
  • T to C, chromosome 16 at 76,292,014 bp
  • A to T, chromosome 19 at 5,702,138 bp
  • A to G, chromosome 19 at 6,831,299 bp
  • A to G, chromosome 19 at 47,620,273 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R8988 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068820-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.