Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9017Btlr/Mmmh
Stock Number:
068847-MU
Citation ID:
RRID:MMRRC_068847-MU
Other Names:
R9017 (G1)
Major Collection:

Strain Information

Cep70
Name: centrosomal protein 70
Synonyms: 6720484E09Rik, C030018L16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68121
Homologene: 11387
Prepl
Name: prolyl endopeptidase-like
Synonyms: 9530014L06Rik, 2810457N15Rik, D030028O16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213760
VEGA: 17
Homologene: 15481
Gpr55
Name: G protein-coupled receptor 55
Synonyms: LOC227326, CTFL
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227326
HGNC: HGNC:4511
Homologene: 36184
Hcn4
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330953
VEGA: 9
Homologene: 3997
E2f3
Name: E2F transcription factor 3
Synonyms: E2F3b, E2f3a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13557
HGNC: HGNC:3115
Homologene: 74413
Psmd1
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Synonyms: P112, S1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70247
HGNC: HGNC:9554
Homologene: 2100
Kif20b
Name: kinesin family member 20B
Synonyms: N-6 kinesin, C330014J10Rik, Kif20b, Mphosph1, 33cex, magoo
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,354,780 bp
  • C to T, chromosome 1 at 36,552,998 bp
  • T to C, chromosome 1 at 85,940,902 bp
  • T to A, chromosome 1 at 86,126,509 bp
  • A to G, chromosome 1 at 97,727,414 bp
  • G to A, chromosome 1 at 105,827,129 bp
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp
  • G to A, chromosome 2 at 70,585,862 bp
  • G to T, chromosome 2 at 76,907,587 bp
  • G to T, chromosome 2 at 88,909,607 bp
  • A to T, chromosome 2 at 91,494,052 bp
  • A to T, chromosome 2 at 126,433,921 bp
  • A to G, chromosome 3 at 103,088,470 bp
  • A to G, chromosome 3 at 109,155,079 bp
  • A to T, chromosome 3 at 155,087,266 bp
  • T to C, chromosome 4 at 41,299,411 bp
  • A to G, chromosome 4 at 86,825,112 bp
  • T to A, chromosome 4 at 118,726,368 bp
  • G to T, chromosome 5 at 44,047,528 bp
  • C to A, chromosome 5 at 51,472,909 bp
  • T to C, chromosome 5 at 73,607,901 bp
  • A to T, chromosome 5 at 120,480,590 bp
  • T to C, chromosome 5 at 127,789,872 bp
  • T to C, chromosome 5 at 128,269,252 bp
  • T to C, chromosome 5 at 129,716,793 bp
  • A to G, chromosome 5 at 143,288,488 bp
  • G to A, chromosome 6 at 113,412,889 bp
  • A to T, chromosome 7 at 86,306,749 bp
  • C to T, chromosome 7 at 114,416,460 bp
  • G to A, chromosome 8 at 23,116,248 bp
  • T to G, chromosome 8 at 45,795,737 bp
  • T to A, chromosome 8 at 48,254,633 bp
  • A to G, chromosome 8 at 105,378,700 bp
  • T to C, chromosome 8 at 122,857,517 bp
  • A to G, chromosome 8 at 123,308,568 bp
  • T to C, chromosome 9 at 58,824,199 bp
  • T to C, chromosome 9 at 99,299,776 bp
  • T to A, chromosome 9 at 107,534,681 bp
  • T to C, chromosome 10 at 44,004,481 bp
  • T to A, chromosome 10 at 49,113,459 bp
  • T to C, chromosome 10 at 81,179,653 bp
  • C to T, chromosome 10 at 92,816,021 bp
  • T to A, chromosome 11 at 72,247,762 bp
  • T to A, chromosome 11 at 105,325,885 bp
  • T to C, chromosome 11 at 115,323,605 bp
  • A to G, chromosome 12 at 70,267,239 bp
  • G to A, chromosome 12 at 103,108,615 bp
  • T to C, chromosome 13 at 22,294,084 bp
  • A to G, chromosome 13 at 23,099,911 bp
  • T to G, chromosome 13 at 29,913,495 bp
  • C to T, chromosome 13 at 93,092,064 bp
  • A to T, chromosome 14 at 44,331,401 bp
  • A to T, chromosome 14 at 52,313,262 bp
  • T to C, chromosome 14 at 66,148,833 bp
  • G to A, chromosome 15 at 30,881,170 bp
  • G to T, chromosome 15 at 101,742,665 bp
  • A to T, chromosome 16 at 32,794,470 bp
  • T to C, chromosome 16 at 56,732,848 bp
  • T to A, chromosome 17 at 23,745,763 bp
  • T to C, chromosome 17 at 31,851,571 bp
  • C to T, chromosome 17 at 85,068,938 bp
  • A to T, chromosome 18 at 20,043,911 bp
  • A to G, chromosome 18 at 67,409,480 bp
  • G to A, chromosome 19 at 9,010,123 bp
  • T to C, chromosome 19 at 34,949,803 bp
  • T to C, chromosome 19 at 47,669,459 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9017 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068847-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.