Strain Name:
C57BL/6J-MtgxR9017Btlr/Mmmh
Stock Number:
068847-MU
Citation ID:
RRID:MMRRC_068847-MU
Other Names:
R9017 (G1)
Major Collection:

Strain Information

Cep70
Name: centrosomal protein 70
Synonyms: 6720484E09Rik, C030018L16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68121
Homologene: 11387
Prepl
Name: prolyl endopeptidase-like
Synonyms: 9530014L06Rik, 2810457N15Rik, D030028O16Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 213760
VEGA: 17
Homologene: 15481
Gpr55
Name: G protein-coupled receptor 55
Synonyms: CTFL, LOC227326
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227326
HGNC: HGNC:4511
Homologene: 36184
Hcn4
Name: hyperpolarization-activated, cyclic nucleotide-gated K+ 4
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 330953
VEGA: 9
Homologene: 3997
E2f3
Name: E2F transcription factor 3
Synonyms: E2F3b, E2f3a
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13557
HGNC: HGNC:3115
Homologene: 74413
Psmd1
Name: proteasome (prosome, macropain) 26S subunit, non-ATPase, 1
Synonyms: P112, S1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70247
HGNC: HGNC:9554
Homologene: 2100
Kif20b
Name: kinesin family member 20B
Synonyms: Kif20b, N-6 kinesin, 33cex, Mphosph1, magoo, C330014J10Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240641
VEGA: 19
HGNC: HGNC:7212
Homologene: 9418
Dennd4c
Name: DENN domain containing 4C
Synonyms: 1700065A05Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 329877
Homologene: 23057
Eef2
Name: eukaryotic translation elongation factor 2
Synonyms: Ef-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13629
VEGA: 10
HGNC: HGNC:3214
Homologene: 134867
Afg3l2
Name: AFG3-like AAA ATPase 2
Synonyms: par, Emv66, 2310036I02Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 69597
VEGA: 18
HGNC: HGNC:315
Homologene: 4947
Chrna2
Name: cholinergic receptor nicotinic alpha 2 subunit
Synonyms: Acra-2, Acra2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 110902
HGNC: HGNC:1956
Homologene: 20193
Kansl3
Name: KAT8 regulatory NSL complex subunit 3
Synonyms: 4632411B12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226976
Homologene: 9949
Gad1
Name: glutamate decarboxylase 1
Synonyms: GAD44, GAD67, Z49976, Gad-1, EP10, GAD25
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 14415
HGNC: HGNC:4092
Homologene: 635
Pex19
Name: peroxisomal biogenesis factor 19
Synonyms: peroxisome biogenesis factor 19, Pxf
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19298
HGNC: HGNC:9713
Homologene: 134253
Tenm3
Name: teneurin transmembrane protein 3
Synonyms: 2610100B16Rik, Ten-m3, Odz3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 23965
Homologene: 22673
Ppip5k2
Name: diphosphoinositol pentakisphosphate kinase 2
Synonyms: Cfap160, Vip2, Hisppd1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227399
Homologene: 49409
Ctnnd2
Name: catenin delta 2
Synonyms: Nprap, neurojugin, catenin (cadherin associated protein), delta 2, Catnd2
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18163
VEGA: 15
HGNC: HGNC:2516
Homologene: 55574
Trim9
Name: tripartite motif-containing 9
Synonyms: C030048G07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 94090
VEGA: 12
Homologene: 9045
Ttn
Name: titin
Synonyms: 2310074I15Rik, D330041I19Rik, 2310057K23Rik, connectin, 2310036G12Rik, shru, D830007G01Rik, L56, 1100001C23Rik, mdm
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Cmya5
Name: cardiomyopathy associated 5
Synonyms: Myospryn, 2310076E21Rik, 2310076E16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76469
VEGA: 13
Homologene: 137367
Plekhg4
Name: pleckstrin homology domain containing, family G (with RhoGef domain) member 4
Synonyms: 4931414L13Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 102075
Homologene: 18516
Slc13a5
Name: solute carrier family 13 (sodium-dependent citrate transporter), member 5
Synonyms: Nact, NaC2/NaCT, mINDY, Indy
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237831
Homologene: 21941
Sik1
Name: salt inducible kinase 1
Synonyms: Msk, Snf1lk
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17691
VEGA: 17
Homologene: 7847
Lrp4
Name: low density lipoprotein receptor-related protein 4
Synonyms: mdig, Megf7, 6430526J12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228357
HGNC: HGNC:6696
Homologene: 17964
Krt71
Name: keratin 71
Synonyms: Cal4, Ca, mK6irs1, Cu, Krt2-6g, mK6irs
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 56735
Homologene: 88864
Unc79
Name: unc-79 homolog
Synonyms: Mlca3, 9030205A07Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217843
Homologene: 41397
Ahnak
Name: AHNAK nucleoprotein
Synonyms: 1110004P15Rik, DY6, 2310047C17Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 66395
VEGA: 19
HGNC: HGNC:347
Homologene: 67425
Kremen2
Name: kringle containing transmembrane protein 2
Synonyms: Krm2, 2900054E04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 73016
VEGA: 17
Homologene: 65132
Sorbs2
Name: sorbin and SH3 domain containing 2
Synonyms: 2010203O03Rik, 9430041O17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234214
Homologene: 83295
Crybg1
Name: crystallin beta-gamma domain containing 1
Synonyms: Aim1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 11630
HGNC: HGNC:356
Homologene: 18168
Dcaf12
Name: DDB1 and CUL4 associated factor 12
Synonyms: Wdr40a, 5830424K06Rik, 1500001L20Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68970
Homologene: 49418
Tmem132d
Name: transmembrane protein 132D
Synonyms: C630028F04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243274
Homologene: 71684
Vmn1r216
Name: vomeronasal 1 receptor 216
Synonyms: V1ri10
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171279
Homologene: 110880
Fanca
Name: Fanconi anemia, complementation group A
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14087
HGNC: HGNC:3582
Homologene: 108
Lrrc66
Name: leucine rich repeat containing 66
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231296
Homologene: 51944
Or13p8
Name: olfactory receptor family 13 subfamily P member 8
Synonyms: GA_x6K02T2QD9B-18823451-18822504, Olfr1340, MOR258-6
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 258301
Homologene: 122779
Ampd1
Name: adenosine monophosphate deaminase 1
Synonyms: Ampd-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229665
HGNC: HGNC:468
Homologene: 20
Or4c29
Name: olfactory receptor family 4 subfamily C member 29
Synonyms: GA_x6K02T2Q125-50386882-50385950, MOR230-7, Olfr1209
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258453
Homologene: 128155
Pde3b
Name: phosphodiesterase 3B, cGMP-inhibited
Synonyms: 9830102A01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18576
HGNC: HGNC:8779
Homologene: 709
Col17a1
Name: collagen, type XVII, alpha 1
Synonyms: Bpag2, BPAg2, BP180, Bpag
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 12821
HGNC: HGNC:2194
Homologene: 7276
Mrc2
Name: mannose receptor, C type 2
Synonyms: uPARAP, Endo180, novel lectin
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 17534
Homologene: 4408
Dsc2
Name: desmocollin 2
Synonyms: Dsc2b, Dsc2a
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13506
HGNC: HGNC:3036
Homologene: 8397
Cdh15
Name: cadherin 15
Synonyms: Cdh14, M cadherin, Mcad
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12555
HGNC: HGNC:1754
Homologene: 3622
Slc25a24
Name: solute carrier family 25 (mitochondrial carrier, phosphate carrier), member 24
Synonyms: 2610016M12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229731
Homologene: 92693
Atp8b4
Name: ATPase, class I, type 8B, member 4
Synonyms: Im
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241633
Homologene: 133162
Tnfrsf11a
Name: tumor necrosis factor receptor superfamily, member 11a, NFKB activator
Synonyms: TRANCE-R, Rank
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21934
Homologene: 2848
Grik2
Name: glutamate receptor, ionotropic, kainate 2 (beta 2)
Synonyms: Glur6, Glur-6, Glurbeta2, C130030K03Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14806
HGNC: HGNC:4580
Homologene: 40717
Mrps17
Name: mitochondrial ribosomal protein S17
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 66258
Homologene: 9320
Or13g1
Name: olfactory receptor family 13 subfamily G member 1
Synonyms: MOR251-4P, GA_x6K02T2NHDJ-9801340-9802266, Olfr309
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258196
Homologene: 47595
Ttll3
Name: tubulin tyrosine ligase-like family, member 3
Synonyms: 4833441J24Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 101100
Homologene: 134361
Vmn1r196
Name: vomeronasal 1 receptor 196
Synonyms: V1rh19
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 100312484
Homologene: 110880
Sema4c
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4C
Synonyms: Semacl1, Semai, Semacl1, M-Sema F, Semaf
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20353
Homologene: 23047
Adgrg7
Name: adhesion G protein-coupled receptor G7
Synonyms: Gpr128, 9130020O16Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239853
Homologene: 13115
Tmem115
Name: transmembrane protein 115
Synonyms: Pl6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 56395
Homologene: 135207
Sall2
Name: spalt like transcription factor 2
Synonyms: Msal-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 50524
Homologene: 9269
Ppargc1a
Name: peroxisome proliferative activated receptor, gamma, coactivator 1 alpha
Synonyms: Pgc-1alpha, Pgc-1alphaa, Pgco1, Pgc1, A830037N07Rik, Gm11133, PPAR Gamma Coactivator-1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19017
HGNC: HGNC:9237
Homologene: 7485
Fpgt
Name: fucose-1-phosphate guanylyltransferase
Synonyms: 1700016E03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75540
HGNC: HGNC:3825
Homologene: 2847
Sds
Name: serine dehydratase
Synonyms: SDH
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231691
Homologene: 38235
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, 4930485B16Rik, Gm872
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Zfp853
Name: zinc finger protein 853
Synonyms: LOC330230
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 330230
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 36,354,780 bp
  • C to T, chromosome 1 at 36,552,998 bp
  • T to C, chromosome 1 at 85,940,902 bp
  • T to A, chromosome 1 at 86,126,509 bp
  • A to G, chromosome 1 at 97,727,414 bp
  • G to A, chromosome 1 at 105,827,129 bp
  • GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC to GTCTCTTGTCTCCGAAGGTGCTCTTGATGATTTC, chromosome 1 at 172,128,583 bp
  • G to A, chromosome 2 at 70,585,862 bp
  • G to T, chromosome 2 at 76,907,587 bp
  • G to T, chromosome 2 at 88,909,607 bp
  • A to T, chromosome 2 at 91,494,052 bp
  • A to T, chromosome 2 at 126,433,921 bp
  • A to G, chromosome 3 at 103,088,470 bp
  • A to G, chromosome 3 at 109,155,079 bp
  • A to T, chromosome 3 at 155,087,266 bp
  • T to C, chromosome 4 at 41,299,411 bp
  • A to G, chromosome 4 at 86,825,112 bp
  • T to A, chromosome 4 at 118,726,368 bp
  • G to T, chromosome 5 at 44,047,528 bp
  • C to A, chromosome 5 at 51,472,909 bp
  • T to C, chromosome 5 at 73,607,901 bp
  • A to T, chromosome 5 at 120,480,590 bp
  • T to C, chromosome 5 at 127,789,872 bp
  • T to C, chromosome 5 at 128,269,252 bp
  • T to C, chromosome 5 at 129,716,793 bp
  • A to G, chromosome 5 at 143,288,488 bp
  • G to A, chromosome 6 at 113,412,889 bp
  • A to T, chromosome 7 at 86,306,749 bp
  • C to T, chromosome 7 at 114,416,460 bp
  • G to A, chromosome 8 at 23,116,248 bp
  • T to G, chromosome 8 at 45,795,737 bp
  • T to A, chromosome 8 at 48,254,633 bp
  • A to G, chromosome 8 at 105,378,700 bp
  • T to C, chromosome 8 at 122,857,517 bp
  • A to G, chromosome 8 at 123,308,568 bp
  • T to C, chromosome 9 at 58,824,199 bp
  • T to C, chromosome 9 at 99,299,776 bp
  • T to A, chromosome 9 at 107,534,681 bp
  • T to C, chromosome 10 at 44,004,481 bp
  • T to A, chromosome 10 at 49,113,459 bp
  • T to C, chromosome 10 at 81,179,653 bp
  • C to T, chromosome 10 at 92,816,021 bp
  • T to A, chromosome 11 at 72,247,762 bp
  • T to A, chromosome 11 at 105,325,885 bp
  • T to C, chromosome 11 at 115,323,605 bp
  • A to G, chromosome 12 at 70,267,239 bp
  • G to A, chromosome 12 at 103,108,615 bp
  • T to C, chromosome 13 at 22,294,084 bp
  • A to G, chromosome 13 at 23,099,911 bp
  • T to G, chromosome 13 at 29,913,495 bp
  • C to T, chromosome 13 at 93,092,064 bp
  • A to T, chromosome 14 at 44,331,401 bp
  • A to T, chromosome 14 at 52,313,262 bp
  • T to C, chromosome 14 at 66,148,833 bp
  • G to A, chromosome 15 at 30,881,170 bp
  • G to T, chromosome 15 at 101,742,665 bp
  • A to T, chromosome 16 at 32,794,470 bp
  • T to C, chromosome 16 at 56,732,848 bp
  • T to A, chromosome 17 at 23,745,763 bp
  • T to C, chromosome 17 at 31,851,571 bp
  • C to T, chromosome 17 at 85,068,938 bp
  • A to T, chromosome 18 at 20,043,911 bp
  • A to G, chromosome 18 at 67,409,480 bp
  • G to A, chromosome 19 at 9,010,123 bp
  • T to C, chromosome 19 at 34,949,803 bp
  • T to C, chromosome 19 at 47,669,459 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9017 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068847-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.