Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9023Btlr/Mmmh
Stock Number:
068853-MU
Citation ID:
RRID:MMRRC_068853-MU
Other Names:
R9023 (G1)
Major Collection:

Strain Information

Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Dst
Name: dystonin
Synonyms: bullous pemphigoid antigen 1, BPAG1-n, BPAG1, Bpag1, Bpag, ah, bullous pemphigoid antigen 1, athetoid, Macf2, 2310001O04Rik, nmf203, A830042E19Rik, nmf339
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, LEC3, D130075K09Rik, 5430402I23Rik, Lphn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Wasf1
Name: WASP family, member 1
Synonyms: WAVE-1, Scar, WAVE
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83767
Homologene: 2920
Usp15
Name: ubiquitin specific peptidase 15
Synonyms: Gcap18, 4921514G19Rik, E430033I05Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14479
VEGA: 10
Homologene: 101542
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Knl1
Name: kinetochore scaffold 1
Synonyms: 2310043D08Rik, 5730505K17Rik, Casc5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76464
Homologene: 44890
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,114,024 bp
  • T to C, chromosome 1 at 44,114,765 bp
  • T to C, chromosome 1 at 131,212,340 bp
  • T to C, chromosome 1 at 154,205,168 bp
  • A to T, chromosome 1 at 163,990,731 bp
  • C to T, chromosome 1 at 166,641,763 bp
  • C to G, chromosome 2 at 76,136,459 bp
  • T to C, chromosome 2 at 76,795,887 bp
  • T to C, chromosome 2 at 119,070,280 bp
  • T to C, chromosome 2 at 120,171,237 bp
  • C to T, chromosome 2 at 181,424,142 bp
  • T to C, chromosome 3 at 54,194,833 bp
  • A to G, chromosome 3 at 88,985,269 bp
  • A to G, chromosome 3 at 93,692,435 bp
  • A to G, chromosome 4 at 17,996,202 bp
  • A to G, chromosome 4 at 55,007,563 bp
  • A to G, chromosome 4 at 126,506,803 bp
  • C to T, chromosome 5 at 81,465,218 bp
  • C to T, chromosome 5 at 124,719,074 bp
  • T to C, chromosome 5 at 150,437,303 bp
  • T to C, chromosome 5 at 150,541,895 bp
  • A to G, chromosome 6 at 3,373,791 bp
  • G to T, chromosome 6 at 42,322,012 bp
  • A to G, chromosome 6 at 57,618,627 bp
  • A to G, chromosome 6 at 85,910,387 bp
  • A to G, chromosome 6 at 121,659,958 bp
  • GAGGGGGTCTCTGCTGGGGGCCTCTCTGTGGGGGTGGGCCTTGTTGGTTTCCAGGCT to G, chromosome 6 at 132,312,211 bp
  • C to T, chromosome 7 at 4,474,043 bp
  • T to G, chromosome 7 at 26,573,866 bp
  • T to C, chromosome 7 at 44,319,107 bp
  • C to T, chromosome 7 at 103,418,332 bp
  • C to T, chromosome 7 at 104,636,084 bp
  • T to C, chromosome 7 at 127,707,332 bp
  • T to A, chromosome 7 at 141,651,167 bp
  • C to T, chromosome 8 at 25,587,220 bp
  • A to G, chromosome 8 at 111,177,748 bp
  • A to T, chromosome 9 at 7,504,912 bp
  • T to C, chromosome 9 at 26,751,773 bp
  • T to C, chromosome 9 at 39,078,011 bp
  • T to C, chromosome 9 at 62,425,696 bp
  • T to A, chromosome 9 at 65,326,833 bp
  • C to T, chromosome 9 at 76,254,572 bp
  • T to C, chromosome 9 at 106,471,291 bp
  • C to T, chromosome 10 at 24,091,307 bp
  • T to C, chromosome 10 at 40,934,575 bp
  • T to A, chromosome 10 at 58,479,521 bp
  • C to T, chromosome 10 at 61,203,001 bp
  • T to C, chromosome 10 at 76,581,579 bp
  • C to T, chromosome 10 at 123,125,593 bp
  • A to G, chromosome 10 at 128,465,224 bp
  • T to C, chromosome 11 at 54,068,836 bp
  • A to T, chromosome 11 at 59,589,541 bp
  • A to G, chromosome 11 at 77,827,651 bp
  • C to T, chromosome 11 at 82,116,047 bp
  • T to A, chromosome 11 at 87,474,413 bp
  • A to G, chromosome 11 at 90,535,423 bp
  • T to C, chromosome 11 at 103,239,009 bp
  • A to T, chromosome 11 at 117,835,523 bp
  • A to G, chromosome 13 at 32,845,780 bp
  • A to G, chromosome 13 at 55,472,421 bp
  • C to T, chromosome 13 at 73,675,770 bp
  • A to T, chromosome 14 at 26,963,695 bp
  • T to C, chromosome 15 at 66,683,673 bp
  • C to T, chromosome 15 at 81,955,695 bp
  • A to T, chromosome 17 at 43,303,760 bp
  • C to A, chromosome 19 at 29,570,743 bp
  • C to A, chromosome 19 at 32,818,012 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9023 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068853-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.