Strain Name:
C57BL/6J-MtgxR9023Btlr/Mmmh
Stock Number:
068853-MU
Citation ID:
RRID:MMRRC_068853-MU
Other Names:
R9023 (G1)
Major Collection:

Strain Information

Mmp10
Name: matrix metallopeptidase 10
Synonyms: stromelysin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17384
VEGA: 9
HGNC: HGNC:7156
Homologene: 20546
Dst
Name: dystonin
Synonyms: BPAG1-n, bullous pemphigoid antigen 1, Macf2, nmf203, 2310001O04Rik, BPAG1, nmf339, athetoid, A830042E19Rik, Bpag, Bpag1, bullous pemphigoid antigen 1, ah
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13518
HGNC: HGNC:1090
Homologene: 136716
Adgrl3
Name: adhesion G protein-coupled receptor L3
Synonyms: lectomedin 3, Lphn3, 5430402I23Rik, LEC3, D130075K09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 319387
Homologene: 22878
Wasf1
Name: WASP family, member 1
Synonyms: WAVE, WAVE-1, Scar
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 83767
Homologene: 2920
Usp15
Name: ubiquitin specific peptidase 15
Synonyms: E430033I05Rik, 4921514G19Rik, Gcap18
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14479
VEGA: 10
Homologene: 101542
Fry
Name: FRY microtubule binding protein
Synonyms: 9330186A19Rik, cg003
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Knl1
Name: kinetochore scaffold 1
Synonyms: 5730505K17Rik, 2310043D08Rik, Casc5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 76464
Homologene: 44890
Zfp462
Name: zinc finger protein 462
Synonyms: Gt4-2, Zfpip, 9430078C22Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242466
Homologene: 41430
Tg
Name: thyroglobulin
Synonyms: Tgn
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 21819
Homologene: 2430
Pten
Name: phosphatase and tensin homolog
Synonyms: TEP1, B430203M17Rik, 2310035O07Rik, MMAC1, A130070J02Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19211
HGNC: HGNC:9588
Homologene: 265
Ric1
Name: RAB6A GEF complex partner 1
Synonyms: C130057E09Rik, C030046E11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226089
Homologene: 13806
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: KMT2H, E430018P19Rik, chromatin remodeling factor, 8030453L17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Bcl7c
Name: B cell CLL/lymphoma 7C
Synonyms: C230096E12Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12055
HGNC: HGNC:1006
Homologene: 3498
Mmp16
Name: matrix metallopeptidase 16
Synonyms: MT3-MMP, Membrane type 3-MMP
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17389
HGNC: HGNC:7162
Homologene: 55939
B3gat1
Name: beta-1,3-glucuronyltransferase 1
Synonyms: GlcAT-P, 0710007K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76898
HGNC: HGNC:921
Homologene: 49551
Map3k14
Name: mitogen-activated protein kinase kinase kinase 14
Synonyms: Nik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 53859
HGNC: HGNC:6853
Homologene: 2940
Glg1
Name: golgi apparatus protein 1
Synonyms: MG160, CFR, ESL-1, Selel, CFR-1, MG-160
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 20340
HGNC: HGNC:4316
Homologene: 7533
Brca2
Name: breast cancer 2, early onset
Synonyms: RAB163, Fancd1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12190
HGNC: HGNC:1101
Homologene: 41
Pmm1
Name: phosphomannomutase 1
Synonyms: Secp53 (yeast) homolog
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 29858
HGNC: HGNC:9114
Homologene: 90898
Appl1
Name: adaptor protein, phosphotyrosine interaction, PH domain and leucine zipper containing 1
Synonyms: 7330406P05Rik, 2900057D21Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 72993
Homologene: 32143
Firrm
Name: FIGNL1 interacting regulator of recombination and mitosis
Synonyms: BC055324, Flip
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381306
Homologene: 10058
Smarcc2
Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2
Synonyms: 5930405J04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68094
VEGA: 10
Homologene: 2312
Pla2g4e
Name: phospholipase A2, group IVE
Synonyms: Pla2epsilon, 2310026J01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329502
Homologene: 65339
Ttn
Name: titin
Synonyms: 2310074I15Rik, D330041I19Rik, 2310057K23Rik, connectin, 2310036G12Rik, shru, D830007G01Rik, L56, 1100001C23Rik, mdm
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Zfp648
Name: zinc finger protein 648
Synonyms: Gm10178, LOC207678
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100503355
Homologene: 18996
Nlrp9a
Name: NLR family, pyrin domain containing 9A
Synonyms: D7Ertd565e, Nalp9a, Nalp-theta
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233001
Homologene: 116072
Stxbp4
Name: syntaxin binding protein 4
Synonyms: 6030470M02Rik, Synip
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20913
Homologene: 7963
Pdlim4
Name: PDZ and LIM domain 4
Synonyms: Ril
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 30794
Homologene: 2735
Slc6a18
Name: solute carrier family 6 (neurotransmitter transporter), member 18
Synonyms: Xtrp2, XT2, D630001K16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 22598
VEGA: 13
Homologene: 40785
Eps8l1
Name: EPS8-like 1
Synonyms: EPS8R1, 2310051G19Rik, DRC3, 4632407K17Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67425
Homologene: 15767
Fam131b
Name: family with sequence similarity 131, member B
Synonyms: 6530406I18Rik, 6330503C03Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 76156
Homologene: 8797
Hcrtr2
Name: hypocretin (orexin) receptor 2
Synonyms: OX2r, mOXR2, mOX2bR, mOX2aR
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 387285
HGNC: HGNC:4849
Homologene: 1168
A2m
Name: alpha-2-macroglobulin
Synonyms: A2mp
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232345
HGNC: HGNC:7
Homologene: 37248
Serpinb1a
Name: serine (or cysteine) peptidase inhibitor, clade B, member 1a
Synonyms: ELANH2, LEI, EIA, 1190005M04Rik, MNEI, ovalbumin, M/NEI
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66222
HGNC: HGNC:3311
Homologene: 133768
Parp3
Name: poly (ADP-ribose) polymerase family, member 3
Synonyms: PARP-3, Adprtl3, Adprt3, A930002C11Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235587
HGNC: HGNC:273
Homologene: 4005
Letm2
Name: leucine zipper-EF-hand containing transmembrane protein 2
Synonyms: D030041N04Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 270035
Homologene: 56358
Shank1
Name: SH3 and multiple ankyrin repeat domains 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243961
Homologene: 22949
Samd9l
Name: sterile alpha motif domain containing 9-like
Synonyms: ESTM25
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 209086
HGNC: HGNC:1349
Homologene: 7707
Zbtb46
Name: zinc finger and BTB domain containing 46
Synonyms: 2610019F01Rik, Btbd4, 4933406L05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72147
Homologene: 81908
Atp6v0a2
Name: ATPase, H+ transporting, lysosomal V0 subunit A2
Synonyms: 8430408C20Rik, TJ6s, Atp6n2, ATP6a2, Tj6, V-ATPase a2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 21871
Homologene: 56523
Ago4
Name: argonaute RISC catalytic subunit 4
Synonyms: 5730550L01Rik, argonaute 4, Eif2c4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76850
Homologene: 41184
Tex14
Name: testis expressed gene 14 intercellular bridge forming factor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83560
Homologene: 12838
Clpx
Name: caseinolytic mitochondrial matrix peptidase chaperone subunit
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270166
HGNC: HGNC:2088
Homologene: 4851
Adgrf1
Name: adhesion G protein-coupled receptor F1
Synonyms: Gpr110, 5031409J19Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 77596
Homologene: 124643
Herc6
Name: hect domain and RLD 6
Synonyms: 1700121D12Rik, Herc5, 2510038N07Rik, CEB1, 4930427L17Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67138
Homologene: 70768
Pde11a
Name: phosphodiesterase 11A
Synonyms: 6330414F14Rik, A630086N24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241489
HGNC: HGNC:8773
Homologene: 56763
Afmid
Name: arylformamidase
Synonyms: 9030621K19Rik, Kf, formylkynureninase, formylase, kynurenine formamidase
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 71562
Homologene: 41731
Coro2b
Name: coronin, actin binding protein, 2B
Synonyms: E130012P22Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235431
HGNC: HGNC:2256
Homologene: 21228
Rassf5
Name: Ras association (RalGDS/AF-6) domain family member 5
Synonyms: Rapl, Nore1B, Nore1A, 1300019G20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 54354
Homologene: 10296
Poglut2
Name: protein O-glucosyltransferase 2
Synonyms: 5730416C13Rik, 1810049A15Rik, EP58, Kdelc1, Kdel1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 72050
Homologene: 11367
Trpc4
Name: transient receptor potential cation channel, subfamily C, member 4
Synonyms: Trp4, STRPC4, Trrp4, CCE1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 22066
Homologene: 22955
Or8g24
Name: olfactory receptor family 8 subfamily G member 24
Synonyms: MOR171-25, Olfr938, GA_x6K02T2PVTD-32774646-32773699
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258430
VEGA: 9
Adamts14
Name: ADAM metallopeptidase with thrombospondin type 1 motif 14
Synonyms: Adamts-14, TS14
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237360
Homologene: 16383
Taar8b
Name: trace amine-associated receptor 8B
Synonyms: LOC382348
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 382348
Homologene: 77586
Prb1b
Name: proline-rich protein BstNI subfamily 1B
Synonyms: Prpmp5, MP5
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 381832
Ftcd
Name: formiminotransferase cyclodeaminase
Synonyms: glutamate formiminotransferase
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 14317
HGNC: HGNC:3974
Homologene: 4848
Nat8f1
Name: N-acetyltransferase 8 (GCN5-related) family member 1
Synonyms: Cml1, 1110002I11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66116
Homologene: 41446
Or56b1
Name: olfactory receptor family 56 subfamily B member 1
Synonyms: MOR40-13, Olfr657, GA_x6K02T2PBJ9-7263864-7264823
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258309
Homologene: 17189
Prr7
Name: proline rich 7 (synaptic)
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 432763
VEGA: 13
Homologene: 57114
Or2aa1
Name: olfactory receptor family 2 subfamily AA member 1
Synonyms: GA_x6K02T000SA-78-1037, Olfr223, MOR256-30
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258421
Homologene: 73917
Tdpoz6
Name: TD and POZ domain containing 6
Synonyms: Gm37596, Gm9107
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 668325
Ccl8
Name: C-C motif chemokine ligand 8
Synonyms: MCP-2, HC14, Scya8, 1810063B20Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20307
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 34,114,024 bp
  • T to C, chromosome 1 at 44,114,765 bp
  • T to C, chromosome 1 at 131,212,340 bp
  • T to C, chromosome 1 at 154,205,168 bp
  • A to T, chromosome 1 at 163,990,731 bp
  • C to T, chromosome 1 at 166,641,763 bp
  • C to G, chromosome 2 at 76,136,459 bp
  • T to C, chromosome 2 at 76,795,887 bp
  • T to C, chromosome 2 at 119,070,280 bp
  • T to C, chromosome 2 at 120,171,237 bp
  • C to T, chromosome 2 at 181,424,142 bp
  • T to C, chromosome 3 at 54,194,833 bp
  • A to G, chromosome 3 at 88,985,269 bp
  • A to G, chromosome 3 at 93,692,435 bp
  • A to G, chromosome 4 at 17,996,202 bp
  • A to G, chromosome 4 at 55,007,563 bp
  • A to G, chromosome 4 at 126,506,803 bp
  • C to T, chromosome 5 at 81,465,218 bp
  • C to T, chromosome 5 at 124,719,074 bp
  • T to C, chromosome 5 at 150,437,303 bp
  • T to C, chromosome 5 at 150,541,895 bp
  • A to G, chromosome 6 at 3,373,791 bp
  • G to T, chromosome 6 at 42,322,012 bp
  • A to G, chromosome 6 at 57,618,627 bp
  • A to G, chromosome 6 at 85,910,387 bp
  • A to G, chromosome 6 at 121,659,958 bp
  • GAGGGGGTCTCTGCTGGGGGCCTCTCTGTGGGGGTGGGCCTTGTTGGTTTCCAGGCT to G, chromosome 6 at 132,312,211 bp
  • C to T, chromosome 7 at 4,474,043 bp
  • T to G, chromosome 7 at 26,573,866 bp
  • T to C, chromosome 7 at 44,319,107 bp
  • C to T, chromosome 7 at 103,418,332 bp
  • C to T, chromosome 7 at 104,636,084 bp
  • T to C, chromosome 7 at 127,707,332 bp
  • T to A, chromosome 7 at 141,651,167 bp
  • C to T, chromosome 8 at 25,587,220 bp
  • A to G, chromosome 8 at 111,177,748 bp
  • A to T, chromosome 9 at 7,504,912 bp
  • T to C, chromosome 9 at 26,751,773 bp
  • T to C, chromosome 9 at 39,078,011 bp
  • T to C, chromosome 9 at 62,425,696 bp
  • T to A, chromosome 9 at 65,326,833 bp
  • C to T, chromosome 9 at 76,254,572 bp
  • T to C, chromosome 9 at 106,471,291 bp
  • C to T, chromosome 10 at 24,091,307 bp
  • T to C, chromosome 10 at 40,934,575 bp
  • T to A, chromosome 10 at 58,479,521 bp
  • C to T, chromosome 10 at 61,203,001 bp
  • T to C, chromosome 10 at 76,581,579 bp
  • C to T, chromosome 10 at 123,125,593 bp
  • A to G, chromosome 10 at 128,465,224 bp
  • T to C, chromosome 11 at 54,068,836 bp
  • A to T, chromosome 11 at 59,589,541 bp
  • A to G, chromosome 11 at 77,827,651 bp
  • C to T, chromosome 11 at 82,116,047 bp
  • T to A, chromosome 11 at 87,474,413 bp
  • A to G, chromosome 11 at 90,535,423 bp
  • T to C, chromosome 11 at 103,239,009 bp
  • A to T, chromosome 11 at 117,835,523 bp
  • A to G, chromosome 13 at 32,845,780 bp
  • A to G, chromosome 13 at 55,472,421 bp
  • C to T, chromosome 13 at 73,675,770 bp
  • A to T, chromosome 14 at 26,963,695 bp
  • T to C, chromosome 15 at 66,683,673 bp
  • C to T, chromosome 15 at 81,955,695 bp
  • A to T, chromosome 17 at 43,303,760 bp
  • C to A, chromosome 19 at 29,570,743 bp
  • C to A, chromosome 19 at 32,818,012 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9023 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068853-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.