Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9030Btlr/Mmmh
Stock Number:
068859-MU
Citation ID:
RRID:MMRRC_068859-MU
Other Names:
R9030 (G1)
Major Collection:

Strain Information

Sf1
Name: splicing factor 1
Synonyms: WBP4, MZFM, CW17R, Zfp162
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 22668
Homologene: 134065
Cep55
Name: centrosomal protein 55
Synonyms: 2700032M20Rik, 1200008O12Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 74107
VEGA: 19
HGNC: HGNC:1161
Homologene: 10019
Rprd2
Name: regulation of nuclear pre-mRNA domain containing 2
Synonyms: 6720469I21Rik, 2810036A19Rik, 4930535B03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75137
Homologene: 19997
P4htm
Name: prolyl 4-hydroxylase, transmembrane (endoplasmic reticulum)
Synonyms: 4933406E20Rik, P4h-tm
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74443
Homologene: 41765
Pdzd2
Name: PDZ domain containing 2
Synonyms: 4930537L06Rik, LOC223364, A930022H17Rik, Pdzk3, Gm21706
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68070
Homologene: 23393
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: U5-200KD, HELIC2, A330064G03Rik, Ascc3l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320632
Homologene: 5859
Adgrl2
Name: adhesion G protein-coupled receptor L2
Synonyms: Lphh1, Lec1, Lphn2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99633
Homologene: 22712
Chd9
Name: chromodomain helicase DNA binding protein 9
Synonyms: 1810014J18Rik, AD013, A330063D19Rik, 9030205D12Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 109151
Homologene: 11844
Hif1a
Name: hypoxia inducible factor 1, alpha subunit
Synonyms: MOP1, HIF-1alpha, HIF1alpha, bHLHe78
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 15251
HGNC: HGNC:4910
Homologene: 1171
Cdc73
Name: cell division cycle 73, Paf1/RNA polymerase II complex component
Synonyms: C130030P16Rik, 8430414L16Rik, Hrpt2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 214498
Homologene: 11571
Rims2
Name: regulating synaptic membrane exocytosis 2
Synonyms: RIM2, 2810036I15Rik, Syt3-rs
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 116838
VEGA: 15
Homologene: 81639
Wdr37
Name: WD repeat domain 37
Synonyms: 3110035P10Rik, 4933417A01Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 207615
Homologene: 40914
Tubb3
Name: tubulin, beta 3 class III
Synonyms: 3200002H15Rik, betaIII-tubulin, Tuj1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 22152
Homologene: 68503
Dsp
Name: desmoplakin
Synonyms: DP, 2300002E22Rik, 5730453H04Rik, rul
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 109620
HGNC: HGNC:3052
Homologene: 37922
Ccn3
Name: cellular communication network factor 3
Synonyms: C130088N23Rik, CCN3, Nov
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18133
HGNC: HGNC:7885
Homologene: 1884
Zfp799
Name: zinc finger protein 799
Synonyms: 6030490I01Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 240064
Homologene: 107106
Fan1
Name: FANCD2/FANCI-associated nuclease 1
Synonyms: 6030441H18Rik, Mtmr15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 330554
Homologene: 45598
Gm94
Name: predicted gene 94
Synonyms: LOC225443
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225443
VEGA: 18
Homologene: 19192
Dgke
Name: diacylglycerol kinase, epsilon
Synonyms: DAGK6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56077
HGNC: HGNC:2852
Homologene: 2705
Tmco1
Name: transmembrane and coiled-coil domains 1
Synonyms: ESTM39, 1190006A08Rik, 4930403O06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68944
Homologene: 10384
Ddit4
Name: DNA-damage-inducible transcript 4
Synonyms: Dig2, REDD1, Rtp801, 5830413E08Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74747
VEGA: 10
Homologene: 10400
Tex30
Name: testis expressed 30
Synonyms: 3110030D08Rik, 1700029F09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75623
Homologene: 16344
Tbc1d32
Name: TBC1 domain family, member 32
Synonyms: Bromi, C6orf170, D630037F22Rik, b2b2284Clo
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 544696
VEGA: 10
Homologene: 51889
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Lin52
Name: lin-52 DREAM MuvB core complex component
Synonyms: 5830457H20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217708
VEGA: 12
Homologene: 15655
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Lrrc74b
Name: leucine rich repeat containing 74B
Synonyms: 4930451C15Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 74685
Homologene: 25894
Fer1l6
Name: fer-1 like family member 6
Synonyms: EG631797
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 631797
Homologene: 53396
Vmn2r116
Name: vomeronasal 2, receptor 116
Synonyms: EG619697, V2Rp5
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 619697
Homologene: 86604
Nlrp2
Name: NLR family, pyrin domain containing 2
Synonyms: PYPAF2, E330007A02Rik, Nalp2, Pan1, Nbs1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232827
Homologene: 56789
Cdh7
Name: cadherin 7, type 2
Synonyms: CDH7L1, 9330156F07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241201
HGNC: HGNC:1766
Homologene: 68391
Pnpla5
Name: patatin-like phospholipase domain containing 5
Synonyms: GS2L, 4833426H19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75772
VEGA: 15
Homologene: 13376
Grik3
Name: glutamate receptor, ionotropic, kainate 3
Synonyms: Glur-7, Glur7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14807
HGNC: HGNC:4581
Homologene: 73901
Ephx4
Name: epoxide hydrolase 4
Synonyms: LOC384214, Abhd7
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384214
Homologene: 62402
Fndc8
Name: fibronectin type III domain containing 8
Synonyms: 4930466G16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 78919
Homologene: 9716
Prorp
Name: protein only RNase P catalytic subunit
Synonyms: 1110008L16Rik, Mrpp3
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66132
Homologene: 45935
Gbp7
Name: guanylate binding protein 7
Synonyms: 9830147J24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229900
Homologene: 138296
Tex10
Name: testis expressed gene 10
Synonyms: clone 18330, 2810462N03Rik, 2610206N19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269536
Homologene: 32361
Gucy2e
Name: guanylate cyclase 2e
Synonyms: ROS-GC1, GC-E, GC1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 14919
HGNC: HGNC:4689
Homologene: 55442
Vmn2r108
Name: vomeronasal 2, receptor 108
Synonyms: EG627805
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 627805
Homologene: 129678
Sqor
Name: sulfide quinone oxidoreductase
Synonyms: flavo-binding protein, 4930557M22Rik, 0610039J17Rik, Sqrdl
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59010
Homologene: 10921
Dsg1a
Name: desmoglein 1 alpha
Synonyms: Dsg1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13510
HGNC: HGNC:3048
Homologene: 1463
Tnrc18
Name: trinucleotide repeat containing 18
Synonyms: EG381742, Zfp469
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231861
Homologene: 45603
Stac
Name: src homology three (SH3) and cysteine rich domain
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20840
Homologene: 2371
Tgfbrap1
Name: transforming growth factor, beta receptor associated protein 1
Synonyms: 3110018K12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73122
Homologene: 3141
Nlrp5
Name: NLR family, pyrin domain containing 5
Synonyms: Op1, Mater, Nalp5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 23968
Homologene: 65105
Vmn2r14
Name: vomeronasal 2, receptor 14
Synonyms: EG231591
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231591
Homologene: 129606
Epx
Name: eosinophil peroxidase
Synonyms: EPO
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 13861
HGNC: HGNC:3423
Homologene: 20144
Or2y11
Name: olfactory receptor family 2 subfamily Y member 11
Synonyms: GA_x6K02T2QP88-5884501-5883566, MOR256-26, Olfr1381
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 258461
Homologene: 72463
Pcsk4
Name: proprotein convertase subtilisin/kexin type 4
Synonyms: PC4, SPC5
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18551
HGNC: HGNC:8746
Homologene: 22495
Klk15
Name: kallikrein related-peptidase 15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 317652
Homologene: 77571
Actr5
Name: ARP5 actin-related protein 5
Synonyms: B430109J19Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 109275
Homologene: 6818
Or6c215
Name: olfactory receptor family 6 subfamily C member 215
Synonyms: GA_x6K02T2PULF-11481207-11480248, MOR110-6, Olfr811
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258545
Homologene: 133725
Mapk10
Name: mitogen-activated protein kinase 10
Synonyms: p493F12, JNK3, Serk2, C230008H04Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26414
HGNC: HGNC:6872
Homologene: 56439
Svs4
Name: seminal vesicle secretory protein 4
Synonyms: Svp-2, SVS-IV, Svp4, Svp-4, Svp2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20941
Or5d39
Name: olfactory receptor family 5 subfamily D member 39
Synonyms: GA_x6K02T2Q125-49641892-49640942, MOR174-16, Olfr1167
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258291
Homologene: 138307
Gm5145
Name: predicted pseudogene 5145
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381065
VEGA: 17
Dynlt1c
Name: dynein light chain Tctex-type 1C
Synonyms: Dynlt1d
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 100040563
Homologene: 4754
Sat2
Name: spermidine/spermine N1-acetyl transferase 2
Synonyms: SSAT2, SSAT-2, 2610016A03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 69215
Homologene: 44215
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 43,056,677 bp
  • A to G, chromosome 1 at 44,091,196 bp
  • C to A, chromosome 1 at 110,100,113 bp
  • A to T, chromosome 1 at 143,609,496 bp
  • T to A, chromosome 1 at 150,817,119 bp
  • C to T, chromosome 1 at 167,308,563 bp
  • A to T, chromosome 2 at 88,149,374 bp
  • A to T, chromosome 2 at 122,787,594 bp
  • A to G, chromosome 2 at 127,211,546 bp
  • A to C, chromosome 2 at 158,632,401 bp
  • T to C, chromosome 2 at 164,277,138 bp
  • A to G, chromosome 3 at 95,784,310 bp
  • T to C, chromosome 3 at 142,538,037 bp
  • G to T, chromosome 3 at 148,839,125 bp
  • A to G, chromosome 4 at 48,452,056 bp
  • C to A, chromosome 4 at 125,632,392 bp
  • T to C, chromosome 5 at 102,996,633 bp
  • A to G, chromosome 5 at 107,429,683 bp
  • G to A, chromosome 5 at 109,220,188 bp
  • T to C, chromosome 5 at 142,726,063 bp
  • A to T, chromosome 7 at 5,322,458 bp
  • A to T, chromosome 7 at 23,430,148 bp
  • C to T, chromosome 7 at 43,938,366 bp
  • T to C, chromosome 7 at 64,373,013 bp
  • G to A, chromosome 8 at 90,956,570 bp
  • A to T, chromosome 8 at 123,418,957 bp
  • GATTTATTTATTTATTTATTTATTTATTTATTTATTTATT to GATTTATTTATTTATTTATTTATTTATTTATTTATTTATTTATT, chromosome 9 at 88,582,989 bp
  • G to A, chromosome 9 at 108,597,428 bp
  • C to A, chromosome 9 at 111,690,252 bp
  • A to T, chromosome 10 at 56,161,145 bp
  • A to T, chromosome 10 at 59,950,693 bp
  • A to T, chromosome 10 at 80,329,024 bp
  • G to T, chromosome 10 at 129,802,057 bp
  • T to A, chromosome 11 at 49,551,981 bp
  • T to C, chromosome 11 at 69,225,001 bp
  • T to A, chromosome 11 at 69,622,243 bp
  • A to G, chromosome 11 at 77,421,236 bp
  • A to G, chromosome 11 at 82,898,696 bp
  • A to T, chromosome 11 at 87,872,644 bp
  • A to T, chromosome 11 at 89,050,411 bp
  • T to C, chromosome 12 at 55,379,407 bp
  • T to C, chromosome 12 at 73,936,236 bp
  • T to A, chromosome 12 at 84,545,907 bp
  • C to T, chromosome 13 at 8,835,388 bp
  • T to A, chromosome 13 at 38,168,697 bp
  • A to G, chromosome 15 at 12,374,299 bp
  • C to T, chromosome 15 at 39,476,477 bp
  • A to T, chromosome 15 at 54,752,291 bp
  • A to T, chromosome 15 at 58,630,745 bp
  • A to G, chromosome 15 at 84,113,886 bp
  • A to G, chromosome 16 at 17,549,776 bp
  • A to G, chromosome 17 at 6,603,517 bp
  • A to G, chromosome 17 at 20,470,050 bp
  • A to G, chromosome 17 at 20,571,008 bp
  • A to G, chromosome 17 at 23,384,890 bp
  • A to G, chromosome 17 at 32,820,591 bp
  • A to G, chromosome 18 at 20,340,492 bp
  • A to T, chromosome 18 at 43,781,261 bp
  • C to T, chromosome 19 at 6,376,306 bp
  • T to C, chromosome 19 at 38,071,144 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9030 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068859-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.