Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9031Btlr/Mmmh
Stock Number:
068860-MU
Citation ID:
RRID:MMRRC_068860-MU
Other Names:
R9031 (G1)
Major Collection:

Strain Information

Ebf2
Name: early B cell factor 2
Synonyms: O/E-3, D14Ggc1e, Mmot1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13592
Homologene: 56471
Dlc1
Name: deleted in liver cancer 1
Synonyms: p122-RhoGAP, STARD12, Arhgap7, A730069N07Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 50768
HGNC: HGNC:2897
Homologene: 4442
Cwf19l2
Name: CWF19 like cell cycle control factor 2
Synonyms: 3230401L03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244672
Homologene: 12366
Trim6
Name: tripartite motif-containing 6
Synonyms: D7Ertd684e, C430046K18Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 94088
Homologene: 14381
Cmklr2
Name: chemerin chemokine-like receptor 2
Synonyms: Gpr1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241070
HGNC: HGNC:4463
Homologene: 21094
Rapgef6
Name: Rap guanine nucleotide exchange factor (GEF) 6
Synonyms: PDZ-GEF2, RA-GEF-2, Pdzgef2, C030018K18Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 192786
Homologene: 22968
Helb
Name: helicase (DNA) B
Synonyms: D10Ertd664e
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 117599
Homologene: 50463
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 63,183,986 bp
  • T to C, chromosome 1 at 136,145,304 bp
  • A to G, chromosome 2 at 11,247,008 bp
  • T to C, chromosome 2 at 70,251,750 bp
  • T to C, chromosome 2 at 73,093,716 bp
  • A to G, chromosome 2 at 154,209,928 bp
  • A to T, chromosome 2 at 173,117,251 bp
  • T to A, chromosome 2 at 181,232,468 bp
  • T to C, chromosome 3 at 90,270,881 bp
  • T to C, chromosome 3 at 97,692,359 bp
  • T to C, chromosome 3 at 106,128,461 bp
  • C to T, chromosome 3 at 144,805,714 bp
  • A to G, chromosome 3 at 155,038,509 bp
  • A to C, chromosome 4 at 115,332,002 bp
  • A to G, chromosome 4 at 115,433,668 bp
  • A to G, chromosome 4 at 131,788,380 bp
  • A to T, chromosome 4 at 138,315,745 bp
  • A to G, chromosome 5 at 3,636,844 bp
  • A to T, chromosome 5 at 3,850,963 bp
  • A to G, chromosome 5 at 30,108,264 bp
  • G to A, chromosome 5 at 30,380,188 bp
  • T to C, chromosome 5 at 89,057,709 bp
  • A to T, chromosome 5 at 149,629,805 bp
  • C to T, chromosome 6 at 28,418,183 bp
  • A to T, chromosome 6 at 71,903,474 bp
  • T to C, chromosome 6 at 83,035,522 bp
  • T to C, chromosome 7 at 6,104,609 bp
  • A to T, chromosome 7 at 23,928,809 bp
  • A to T, chromosome 7 at 24,989,787 bp
  • T to G, chromosome 7 at 26,558,273 bp
  • A to G, chromosome 7 at 28,091,483 bp
  • T to A, chromosome 7 at 89,893,150 bp
  • T to G, chromosome 7 at 99,689,007 bp
  • T to C, chromosome 7 at 104,225,952 bp
  • A to G, chromosome 8 at 36,937,901 bp
  • A to G, chromosome 8 at 85,053,534 bp
  • C to T, chromosome 8 at 123,130,212 bp
  • A to G, chromosome 9 at 3,417,942 bp
  • C to T, chromosome 9 at 43,111,369 bp
  • A to T, chromosome 9 at 123,017,427 bp
  • A to T, chromosome 10 at 4,369,183 bp
  • T to C, chromosome 10 at 58,545,071 bp
  • T to G, chromosome 10 at 88,523,044 bp
  • T to C, chromosome 10 at 120,084,885 bp
  • C to T, chromosome 10 at 120,931,973 bp
  • G to A, chromosome 11 at 20,332,532 bp
  • A to G, chromosome 11 at 54,687,841 bp
  • T to C, chromosome 11 at 60,745,869 bp
  • T to G, chromosome 11 at 67,299,315 bp
  • G to T, chromosome 11 at 102,063,273 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • A to T, chromosome 11 at 120,428,542 bp
  • T to C, chromosome 12 at 5,090,537 bp
  • G to C, chromosome 12 at 35,995,566 bp
  • A to T, chromosome 12 at 53,142,048 bp
  • A to G, chromosome 12 at 59,108,800 bp
  • A to T, chromosome 12 at 104,939,612 bp
  • C to T, chromosome 13 at 19,184,999 bp
  • A to T, chromosome 13 at 73,671,703 bp
  • T to C, chromosome 13 at 97,172,693 bp
  • T to G, chromosome 13 at 100,178,268 bp
  • T to A, chromosome 13 at 100,219,830 bp
  • G to A, chromosome 14 at 21,740,165 bp
  • C to T, chromosome 14 at 31,279,171 bp
  • T to A, chromosome 14 at 32,048,070 bp
  • T to C, chromosome 14 at 37,094,019 bp
  • T to A, chromosome 14 at 67,235,145 bp
  • C to A, chromosome 15 at 71,881,674 bp
  • T to A, chromosome 15 at 76,723,761 bp
  • T to A, chromosome 15 at 82,559,222 bp
  • C to T, chromosome 16 at 20,640,625 bp
  • A to G, chromosome 16 at 35,299,489 bp
  • A to G, chromosome 16 at 91,505,191 bp
  • T to C, chromosome 17 at 25,157,523 bp
  • A to G, chromosome 17 at 30,737,427 bp
  • A to G, chromosome 17 at 35,909,489 bp
  • T to C, chromosome 17 at 46,412,507 bp
  • G to T, chromosome 18 at 22,524,344 bp
  • T to C, chromosome 18 at 73,876,840 bp
  • T to C, chromosome 18 at 84,014,862 bp
  • C to A, chromosome 19 at 39,073,219 bp
  • G to A, chromosome 19 at 43,822,027 bp
  • T to A, chromosome 19 at 45,794,771 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9031 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068860-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.