Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9054Btlr/Mmmh
Stock Number:
068880-MU
Citation ID:
RRID:MMRRC_068880-MU
Other Names:
R9054 (G1)
Major Collection:

Strain Information

Chrnb2
Name: cholinergic receptor nicotinic beta 2 subunit
Synonyms: [b]2-nAchR, Acrb-2, Acrb2, C030030P04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11444
HGNC: HGNC:1962
Homologene: 595
Areg
Name: amphiregulin
Synonyms: AR, Sdgf, Mcub
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11839
HGNC: HGNC:651
Homologene: 1252
Rad51c
Name: RAD51 paralog C
Synonyms: Rad51l2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 114714
HGNC: HGNC:9820
Homologene: 14238
Lemd2
Name: LEM domain containing 2
Synonyms: Lem2, NET25
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224640
VEGA: 17
Homologene: 17136
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78798
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
Rlf
Name: rearranged L-myc fusion sequence
Synonyms: 9230110M18Rik, MommeD8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109263
Homologene: 8243
Anln
Name: anillin, actin binding protein
Synonyms: 1110037A17Rik, Scraps, 2900037I21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68743
VEGA: 9
Homologene: 41281
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 52,142,927 bp
  • A to T, chromosome 1 at 171,386,783 bp
  • A to T, chromosome 2 at 17,411,096 bp
  • A to T, chromosome 2 at 35,979,380 bp
  • CGAGGAAGAGGAGGAGGAAGAGGAGGAGGAAGAGGA to CGAGGAAGAGGAGGAGGAAGAGGA, chromosome 2 at 72,483,477 bp
  • T to A, chromosome 2 at 76,740,633 bp
  • A to T, chromosome 2 at 82,975,836 bp
  • T to C, chromosome 2 at 90,460,640 bp
  • T to A, chromosome 2 at 136,553,674 bp
  • A to T, chromosome 2 at 156,095,561 bp
  • T to C, chromosome 3 at 89,757,255 bp
  • A to C, chromosome 3 at 92,340,408 bp
  • A to T, chromosome 3 at 122,934,076 bp
  • A to C, chromosome 4 at 121,150,587 bp
  • T to C, chromosome 4 at 143,965,744 bp
  • A to T, chromosome 5 at 53,703,082 bp
  • A to T, chromosome 5 at 91,144,358 bp
  • C to T, chromosome 6 at 76,942,266 bp
  • G to C, chromosome 6 at 132,361,893 bp
  • C to A, chromosome 7 at 7,116,098 bp
  • G to T, chromosome 7 at 16,810,644 bp
  • T to A, chromosome 7 at 18,353,525 bp
  • A to G, chromosome 7 at 101,507,720 bp
  • A to G, chromosome 7 at 105,368,473 bp
  • G to A, chromosome 7 at 120,670,275 bp
  • G to T, chromosome 8 at 67,491,071 bp
  • C to T, chromosome 8 at 109,521,029 bp
  • A to T, chromosome 8 at 109,665,672 bp
  • T to C, chromosome 8 at 124,332,098 bp
  • G to A, chromosome 8 at 128,487,908 bp
  • T to C, chromosome 9 at 15,324,255 bp
  • A to G, chromosome 9 at 22,360,820 bp
  • C to T, chromosome 9 at 37,711,908 bp
  • A to T, chromosome 9 at 109,089,414 bp
  • A to G, chromosome 10 at 3,540,250 bp
  • G to A, chromosome 10 at 6,823,914 bp
  • C to A, chromosome 10 at 81,033,665 bp
  • T to A, chromosome 11 at 72,056,191 bp
  • T to C, chromosome 11 at 87,402,716 bp
  • T to C, chromosome 12 at 73,546,149 bp
  • T to A, chromosome 13 at 22,383,554 bp
  • T to C, chromosome 13 at 109,935,390 bp
  • T to C, chromosome 13 at 117,971,635 bp
  • A to T, chromosome 14 at 12,213,638 bp
  • T to A, chromosome 14 at 43,782,349 bp
  • G to A, chromosome 15 at 35,422,391 bp
  • A to T, chromosome 15 at 101,786,401 bp
  • G to T, chromosome 17 at 27,204,095 bp
  • A to T, chromosome 17 at 32,634,279 bp
  • G to A, chromosome 17 at 71,363,022 bp
  • T to A, chromosome 17 at 83,427,211 bp
  • A to T, chromosome 19 at 34,076,976 bp
  • A to C, chromosome 19 at 34,648,487 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9054 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068880-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.