Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9054Btlr/Mmmh
Stock Number:
068880-MU
Citation ID:
RRID:MMRRC_068880-MU
Other Names:
R9054 (G1)
Major Collection:

Strain Information

Chrnb2
Name: cholinergic receptor nicotinic beta 2 subunit
Synonyms: [b]2-nAchR, Acrb-2, Acrb2, C030030P04Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11444
HGNC: HGNC:1962
Homologene: 595
Areg
Name: amphiregulin
Synonyms: AR, Sdgf, Mcub
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11839
HGNC: HGNC:651
Homologene: 1252
Rad51c
Name: RAD51 paralog C
Synonyms: Rad51l2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 114714
HGNC: HGNC:9820
Homologene: 14238
Lemd2
Name: LEM domain containing 2
Synonyms: Lem2, NET25
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224640
VEGA: 17
Homologene: 17136
Eml4
Name: echinoderm microtubule associated protein like 4
Synonyms: 4930443C24Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 78798
VEGA: 17
HGNC: HGNC:1316
Homologene: 56841
Rlf
Name: rearranged L-myc fusion sequence
Synonyms: 9230110M18Rik, MommeD8
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 109263
Homologene: 8243
Anln
Name: anillin, actin binding protein
Synonyms: 1110037A17Rik, Scraps, 2900037I21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68743
VEGA: 9
Homologene: 41281
Ptprg
Name: protein tyrosine phosphatase receptor type G
Synonyms: 5430405N12Rik, RPTPgamma
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 19270
HGNC: HGNC:9671
Homologene: 2129
Smchd1
Name: SMC hinge domain containing 1
Synonyms: 4931400A14Rik, MommeD1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74355
Homologene: 23665
Stat1
Name: signal transducer and activator of transcription 1
Synonyms: 2010005J02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20846
Homologene: 21428
Slc39a3
Name: solute carrier family 39 (zinc transporter), member 3
Synonyms: zip3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 106947
Homologene: 44230
Usp53
Name: ubiquitin specific peptidase 53
Synonyms: Sp6, Phxr3, mbo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99526
Homologene: 34521
Ptprj
Name: protein tyrosine phosphatase receptor type J
Synonyms: Byp, DEP-1, Scc-1, Scc1, CD148, RPTPJ
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19271
HGNC: HGNC:9673
Homologene: 2130
Vps13b
Name: vacuolar protein sorting 13B
Synonyms: 1810042B05Rik, Coh1, C330002D13Rik, 2310042E16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666173
VEGA: 15
HGNC: HGNC:2183
Homologene: 49516
Cep295
Name: centrosomal protein 295
Synonyms: LOC382128, 5830418K08Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 319675
Homologene: 27936
Pde4d
Name: phosphodiesterase 4D, cAMP specific
Synonyms: dunce, Dpde3, 9630011N22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 238871
HGNC: HGNC:8783
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Galnt2
Name: polypeptide N-acetylgalactosaminyltransferase 2
Synonyms: ppGaNTase-T2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 108148
HGNC: HGNC:4124
Homologene: 3297
Fsip2
Name: fibrous sheath-interacting protein 2
Synonyms: OTTMUSG00000013335
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241516
Homologene: 110349
Pmfbp1
Name: polyamine modulated factor 1 binding protein 1
Synonyms: F77, 1700016D22Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56523
Homologene: 23182
Tmem30b
Name: transmembrane protein 30B
Synonyms: 9130011B11Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238257
VEGA: 12
Homologene: 133755
Nrp1
Name: neuropilin 1
Synonyms: Neuropilin-1, NP-1, NPN-1, Npn1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18186
HGNC: HGNC:8004
Homologene: 2876
Krt72
Name: keratin 72
Synonyms: K6irs2, Krt72-ps
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 105866
Homologene: 25876
Nebl
Name: nebulette
Synonyms: Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74103
Homologene: 128431
Lipn
Name: lipase, family member N
Synonyms: 2210418G03Rik, Lipl4
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 70166
Homologene: 66969
Ccdc51
Name: coiled-coil domain containing 51
Synonyms: 5730568A12Rik, Mitok
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66658
Homologene: 11646
Pitpnm3
Name: PITPNM family member 3
Synonyms: A330068P14Rik, Ackr6
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327958
Homologene: 66271
Cckar
Name: cholecystokinin A receptor
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 12425
HGNC: HGNC:1570
Homologene: 37337
Zfp954
Name: zinc finger protein 954
Synonyms: 5730403M16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 232853
Homologene: 129792
Rbm12
Name: RNA binding motif protein 12
Synonyms: 5730420G12Rik, SWAN, 9430070C08Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75710
HGNC: HGNC:9898
Homologene: 34993
Psg18
Name: pregnancy specific beta-1-glycoprotein 18
Synonyms: mmCGM6, Cea-3, Cea3
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 26438
Homologene: 110989
Ttll11
Name: tubulin tyrosine ligase-like family, member 11
Synonyms: 4932702F08Rik, D2Ertd624e, 4933424A20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74410
Homologene: 77534
Ctnna2
Name: catenin alpha 2
Synonyms: alpha(N)-catenin, alpha N-catenin, Catna, chp, Catna2, catenin (cadherin associated protein), alpha 2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12386
HGNC: HGNC:2510
Homologene: 68394
Hcn1
Name: hyperpolarization activated cyclic nucleotide gated potassium channel 1
Synonyms: HAC2, Bcng1, C630013B14Rik, hyperpolarization-activated, cyclic nucleotide-gated K+ 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 15165
HGNC: HGNC:4845
Homologene: 32093
Cdca7
Name: cell division cycle associated 7
Synonyms: JPO1, 2310021G01Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 66953
Homologene: 49970
Vmn1r199
Name: vomeronasal 1 receptor 199
Synonyms: V1rh4
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171247
Homologene: 110880
Nat1
Name: N-acetyl transferase 1
Synonyms: Nat-1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 17960
Homologene: 115468
Cyp4f37
Name: cytochrome P450, family 4, subfamily f, polypeptide 37
Synonyms: Gm9705
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 677156
VEGA: 17
Homologene: 135840
Iyd
Name: iodotyrosine deiodinase
Synonyms: 0610009A07Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70337
Homologene: 12352
Ifit1
Name: interferon-induced protein with tetratricopeptide repeats 1
Synonyms: Ifi56, ISG56
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 15957
Homologene: 22462
Pdzd9
Name: PDZ domain containing 9
Synonyms: 4930408O21Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67983
Homologene: 27865
Or52w1
Name: olfactory receptor family 52 subfamily W member 1
Synonyms: GA_x6K02T2PBJ9-7994144-7995106, MOR36-1, Olfr692
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258352
Homologene: 64859
Pde2a
Name: phosphodiesterase 2A, cGMP-stimulated
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 207728
HGNC: HGNC:8777
Homologene: 1952
Fkrp
Name: fukutin related protein
Synonyms: LGMD1I, MDC1C, A830029B19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243853
Homologene: 11513
Ankef1
Name: ankyrin repeat and EF-hand domain containing 1
Synonyms: Ankrd5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319196
Homologene: 11130
Nectin4
Name: nectin cell adhesion molecule 4
Synonyms: nectin 4, Prr4, 1200017F15Rik, Pvrl4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 71740
Homologene: 32744
Or8a1b
Name: olfactory receptor family 8 subfamily A member 1B
Synonyms: M72, MOR171-3, MOR171-3, GA_x6K02T2PVTD-31389446-31388517, Olfr160
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 80706
HGNC: HGNC:8469
Homologene: 12726
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 52,142,927 bp
  • A to T, chromosome 1 at 171,386,783 bp
  • A to T, chromosome 2 at 17,411,096 bp
  • A to T, chromosome 2 at 35,979,380 bp
  • CGAGGAAGAGGAGGAGGAAGAGGAGGAGGAAGAGGA to CGAGGAAGAGGAGGAGGAAGAGGA, chromosome 2 at 72,483,477 bp
  • T to A, chromosome 2 at 76,740,633 bp
  • A to T, chromosome 2 at 82,975,836 bp
  • T to C, chromosome 2 at 90,460,640 bp
  • T to A, chromosome 2 at 136,553,674 bp
  • A to T, chromosome 2 at 156,095,561 bp
  • T to C, chromosome 3 at 89,757,255 bp
  • A to C, chromosome 3 at 92,340,408 bp
  • A to T, chromosome 3 at 122,934,076 bp
  • A to C, chromosome 4 at 121,150,587 bp
  • T to C, chromosome 4 at 143,965,744 bp
  • A to T, chromosome 5 at 53,703,082 bp
  • A to T, chromosome 5 at 91,144,358 bp
  • C to T, chromosome 6 at 76,942,266 bp
  • G to C, chromosome 6 at 132,361,893 bp
  • C to A, chromosome 7 at 7,116,098 bp
  • G to T, chromosome 7 at 16,810,644 bp
  • T to A, chromosome 7 at 18,353,525 bp
  • A to G, chromosome 7 at 101,507,720 bp
  • A to G, chromosome 7 at 105,368,473 bp
  • G to A, chromosome 7 at 120,670,275 bp
  • G to T, chromosome 8 at 67,491,071 bp
  • C to T, chromosome 8 at 109,521,029 bp
  • A to T, chromosome 8 at 109,665,672 bp
  • T to C, chromosome 8 at 124,332,098 bp
  • G to A, chromosome 8 at 128,487,908 bp
  • T to C, chromosome 9 at 15,324,255 bp
  • A to G, chromosome 9 at 22,360,820 bp
  • C to T, chromosome 9 at 37,711,908 bp
  • A to T, chromosome 9 at 109,089,414 bp
  • A to G, chromosome 10 at 3,540,250 bp
  • G to A, chromosome 10 at 6,823,914 bp
  • C to A, chromosome 10 at 81,033,665 bp
  • T to A, chromosome 11 at 72,056,191 bp
  • T to C, chromosome 11 at 87,402,716 bp
  • T to C, chromosome 12 at 73,546,149 bp
  • T to A, chromosome 13 at 22,383,554 bp
  • T to C, chromosome 13 at 109,935,390 bp
  • T to C, chromosome 13 at 117,971,635 bp
  • A to T, chromosome 14 at 12,213,638 bp
  • T to A, chromosome 14 at 43,782,349 bp
  • G to A, chromosome 15 at 35,422,391 bp
  • A to T, chromosome 15 at 101,786,401 bp
  • G to T, chromosome 17 at 27,204,095 bp
  • A to T, chromosome 17 at 32,634,279 bp
  • G to A, chromosome 17 at 71,363,022 bp
  • T to A, chromosome 17 at 83,427,211 bp
  • A to T, chromosome 19 at 34,076,976 bp
  • A to C, chromosome 19 at 34,648,487 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9054 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068880-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.