Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9058Btlr/Mmmh
Stock Number:
068884-MU
Citation ID:
RRID:MMRRC_068884-MU
Other Names:
R9058 (G1)
Major Collection:

Strain Information

Npy1r
Name: neuropeptide Y receptor Y1
Synonyms: Y1-R, Npyr
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18166
HGNC: HGNC:7956
Homologene: 700
Pecam1
Name: platelet/endothelial cell adhesion molecule 1
Synonyms: PECAM-1, Cd31
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18613
HGNC: HGNC:8823
Homologene: 47925
Zfp7
Name: zinc finger protein 7
Synonyms: Krox-2, Zfp-7, KRAB7, Zfp65, mszf73-2, Zfp80, KRAB20, Zfp86-rs1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223669
VEGA: 15
Homologene: 20729
Scaper
Name: S phase cyclin A-associated protein in the ER
Synonyms: D530014O03Rik, Zfp291
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244891
VEGA: 9
Homologene: 32488
Alkbh5
Name: alkB homolog 5, RNA demethylase
Synonyms: Ofoxd, Abh5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 268420
Homologene: 9818
Sec23b
Name: SEC23 homolog B, COPII coat complex component
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27054
Homologene: 74571
Puf60
Name: poly-U binding splicing factor 60
Synonyms: 2810454F19Rik, 2410104I19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 67959
VEGA: 15
Homologene: 8614
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to C, chromosome 1 at 14,889,394 bp
  • A to G, chromosome 1 at 46,243,415 bp
  • G to T, chromosome 1 at 46,766,656 bp
  • A to T, chromosome 1 at 56,637,345 bp
  • A to T, chromosome 1 at 74,569,796 bp
  • A to T, chromosome 1 at 136,070,698 bp
  • C to T, chromosome 1 at 167,308,563 bp
  • A to G, chromosome 2 at 29,204,190 bp
  • G to A, chromosome 2 at 31,908,641 bp
  • T to C, chromosome 2 at 38,694,022 bp
  • T to C, chromosome 2 at 52,185,329 bp
  • T to C, chromosome 2 at 57,112,243 bp
  • A to C, chromosome 2 at 88,746,686 bp
  • T to A, chromosome 2 at 144,582,090 bp
  • A to G, chromosome 2 at 154,238,897 bp
  • A to G, chromosome 3 at 87,085,135 bp
  • A to T, chromosome 3 at 92,428,252 bp
  • T to A, chromosome 4 at 45,283,948 bp
  • T to A, chromosome 4 at 128,722,976 bp
  • T to C, chromosome 4 at 129,293,424 bp
  • A to G, chromosome 5 at 92,571,508 bp
  • A to T, chromosome 5 at 98,784,541 bp
  • G to A, chromosome 5 at 112,378,039 bp
  • C to A, chromosome 5 at 114,415,239 bp
  • A to G, chromosome 5 at 120,480,714 bp
  • G to T, chromosome 5 at 123,614,582 bp
  • T to C, chromosome 6 at 61,373,992 bp
  • T to A, chromosome 6 at 123,336,062 bp
  • A to T, chromosome 7 at 19,469,896 bp
  • A to T, chromosome 7 at 43,189,772 bp
  • C to T, chromosome 7 at 43,938,366 bp
  • A to T, chromosome 7 at 75,140,074 bp
  • T to A, chromosome 7 at 105,684,063 bp
  • G to C, chromosome 7 at 141,638,241 bp
  • T to C, chromosome 8 at 66,703,948 bp
  • A to T, chromosome 8 at 94,512,310 bp
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp
  • T to A, chromosome 9 at 18,988,926 bp
  • T to C, chromosome 9 at 24,769,723 bp
  • T to C, chromosome 9 at 55,815,478 bp
  • T to A, chromosome 9 at 120,951,410 bp
  • T to C, chromosome 10 at 4,413,398 bp
  • T to C, chromosome 10 at 21,382,445 bp
  • G to A, chromosome 10 at 77,696,786 bp
  • A to G, chromosome 10 at 80,186,886 bp
  • C to A, chromosome 10 at 115,362,126 bp
  • T to C, chromosome 11 at 48,895,222 bp
  • T to C, chromosome 11 at 60,553,722 bp
  • T to C, chromosome 11 at 102,255,560 bp
  • G to T, chromosome 11 at 106,699,849 bp
  • T to C, chromosome 11 at 116,189,442 bp
  • G to T, chromosome 12 at 73,775,534 bp
  • T to A, chromosome 12 at 74,235,245 bp
  • A to G, chromosome 12 at 84,173,868 bp
  • A to T, chromosome 12 at 103,853,742 bp
  • T to C, chromosome 13 at 46,791,465 bp
  • C to T, chromosome 15 at 76,070,576 bp
  • C to T, chromosome 15 at 76,072,533 bp
  • C to T, chromosome 15 at 76,108,065 bp
  • T to A, chromosome 15 at 76,880,781 bp
  • A to G, chromosome 15 at 84,757,040 bp
  • T to A, chromosome 15 at 90,497,073 bp
  • G to A, chromosome 16 at 10,784,828 bp
  • T to A, chromosome 16 at 45,772,241 bp
  • A to G, chromosome 16 at 70,527,171 bp
  • T to C, chromosome 17 at 23,716,042 bp
  • A to T, chromosome 17 at 78,935,798 bp
  • T to A, chromosome 18 at 78,102,570 bp
  • G to A, chromosome 19 at 13,479,592 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9058 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068884-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.