Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9085Btlr/Mmmh
Stock Number:
068904-MU
Citation ID:
RRID:MMRRC_068904-MU
Other Names:
R9085 (G1)
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: LOC328902, G430090F17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
Mrpl18
Name: mitochondrial ribosomal protein L18
Synonyms: HSPC071, MRP-L18, 1010001C05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67681
Homologene: 8566
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 2 at 25,204,280 bp
  • A to G, chromosome 2 at 51,934,918 bp
  • A to T, chromosome 2 at 60,425,447 bp
  • T to A, chromosome 2 at 85,430,275 bp
  • A to G, chromosome 2 at 89,406,297 bp
  • C to T, chromosome 2 at 157,283,647 bp
  • T to C, chromosome 2 at 163,225,561 bp
  • T to C, chromosome 2 at 163,438,588 bp
  • A to G, chromosome 3 at 36,221,950 bp
  • T to C, chromosome 3 at 86,126,685 bp
  • T to G, chromosome 3 at 87,979,762 bp
  • C to T, chromosome 3 at 88,981,987 bp
  • T to C, chromosome 3 at 88,984,222 bp
  • T to C, chromosome 3 at 97,694,069 bp
  • C to T, chromosome 3 at 109,506,406 bp
  • T to A, chromosome 3 at 122,014,600 bp
  • C to A, chromosome 3 at 131,619,056 bp
  • A to T, chromosome 4 at 57,041,064 bp
  • T to C, chromosome 4 at 139,367,163 bp
  • T to C, chromosome 4 at 155,000,519 bp
  • T to C, chromosome 5 at 124,762,173 bp
  • C to T, chromosome 5 at 137,600,608 bp
  • A to C, chromosome 6 at 97,292,373 bp
  • A to T, chromosome 6 at 114,225,847 bp
  • G to T, chromosome 6 at 118,638,505 bp
  • A to T, chromosome 6 at 132,737,364 bp
  • A to T, chromosome 6 at 148,336,251 bp
  • T to G, chromosome 7 at 18,614,735 bp
  • A to T, chromosome 7 at 19,065,325 bp
  • T to C, chromosome 7 at 27,036,519 bp
  • T to C, chromosome 7 at 43,411,625 bp
  • T to A, chromosome 7 at 141,700,489 bp
  • C to A, chromosome 8 at 61,349,459 bp
  • A to T, chromosome 8 at 70,796,717 bp
  • T to C, chromosome 8 at 91,287,675 bp
  • A to T, chromosome 9 at 48,339,572 bp
  • G to T, chromosome 9 at 119,124,184 bp
  • C to T, chromosome 10 at 41,810,839 bp
  • G to A, chromosome 10 at 42,318,641 bp
  • T to G, chromosome 10 at 63,148,115 bp
  • T to C, chromosome 10 at 80,904,257 bp
  • G to A, chromosome 10 at 116,939,405 bp
  • G to T, chromosome 11 at 69,429,398 bp
  • A to G, chromosome 11 at 72,306,593 bp
  • G to T, chromosome 11 at 78,530,139 bp
  • A to T, chromosome 11 at 94,443,220 bp
  • A to G, chromosome 11 at 103,616,739 bp
  • T to C, chromosome 11 at 105,130,448 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • C to T, chromosome 11 at 116,545,383 bp
  • C to T, chromosome 11 at 119,029,088 bp
  • T to C, chromosome 12 at 16,573,714 bp
  • T to A, chromosome 12 at 70,030,012 bp
  • T to C, chromosome 12 at 87,336,065 bp
  • C to T, chromosome 12 at 99,388,836 bp
  • T to A, chromosome 12 at 102,492,217 bp
  • T to C, chromosome 13 at 33,397,798 bp
  • A to T, chromosome 13 at 57,423,143 bp
  • T to C, chromosome 13 at 112,524,094 bp
  • A to G, chromosome 14 at 70,616,094 bp
  • A to G, chromosome 14 at 70,636,996 bp
  • A to G, chromosome 15 at 76,173,075 bp
  • A to C, chromosome 16 at 13,412,228 bp
  • A to T, chromosome 17 at 12,915,695 bp
  • T to A, chromosome 17 at 21,464,398 bp
  • C to T, chromosome 17 at 31,603,255 bp
  • T to A, chromosome 17 at 63,921,772 bp
  • T to C, chromosome 18 at 5,766,716 bp
  • T to C, chromosome 18 at 12,929,036 bp
  • G to T, chromosome 19 at 10,866,471 bp
  • G to A, chromosome 19 at 38,178,121 bp
  • C to T, chromosome 19 at 41,055,781 bp
  • A to T, chromosome 19 at 55,233,165 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9085 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068904-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.