Strain Name:
C57BL/6J-MtgxR9085Btlr/Mmmh
Stock Number:
068904-MU
Citation ID:
RRID:MMRRC_068904-MU
Other Names:
R9085 (G1)
Major Collection:

Strain Information

Dntt
Name: deoxynucleotidyltransferase, terminal
Synonyms: Tdt
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 21673
VEGA: 19
HGNC: HGNC:2983
Homologene: 3014
Pknox1
Name: Pbx/knotted 1 homeobox
Synonyms: PREP1, D17Wsu76e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18771
HGNC: HGNC:9022
Homologene: 3363
Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Mkl2, Mrtfb, Gt4-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Nes
Name: nestin
Synonyms: Ifaprc2, Marc2, ESTM46, RC2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Cacna1g
Name: calcium channel, voltage-dependent, T type, alpha 1G subunit
Synonyms: a1G, Cav3.1d
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12291
HGNC: HGNC:1394
Homologene: 22544
Osbpl1a
Name: oxysterol binding protein-like 1A
Synonyms: LOC328902, G430090F17Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 64291
Homologene: 84746
Mrpl18
Name: mitochondrial ribosomal protein L18
Synonyms: HSPC071, 1010001C05Rik, MRP-L18
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 67681
Homologene: 8566
Dmtn
Name: dematin actin binding protein
Synonyms: Epb4.9, dematin
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 13829
VEGA: 14
HGNC: HGNC:3382
Homologene: 1496
Tnfaip1
Name: tumor necrosis factor, alpha-induced protein 1 (endothelial)
Synonyms: Edp1, Tnfip1, Bacurd2, Edp-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 21927
Homologene: 22519
Ube2o
Name: ubiquitin-conjugating enzyme E2O
Synonyms: B230113M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217342
Homologene: 11113
Golga5
Name: golgin A5
Synonyms: Ret-II
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 27277
VEGA: 12
HGNC: HGNC:4428
Homologene: 38009
Sptlc2
Name: serine palmitoyltransferase, long chain base subunit 2
Synonyms: LCB2, Spt2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20773
Homologene: 21610
Zeb1
Name: zinc finger E-box binding homeobox 1
Synonyms: [delta]EF1, AREB6, ZEB, Tw, Zfhep, MEB1, Tcf8, Nil2, Zfhx1a, 3110032K11Rik, Zfx1a, Tcf18
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21417
Homologene: 31779
Fer
Name: FER tyrosine kinase
Synonyms: Fert2, C330004K01Rik, Fert
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14158
VEGA: 17
HGNC: HGNC:3655
Homologene: 74300
Unc13d
Name: unc-13 homolog D
Synonyms: Jinx, Munc13-4, 2610108D09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Sh3d19
Name: SH3 domain protein D19
Synonyms: Kryn
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 27059
Homologene: 19064
Ash1l
Name: ASH1 like histone lysine methyltransferase
Synonyms: chromatin remodeling factor, E430018P19Rik, KMT2H, 8030453L17Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 192195
Homologene: 10225
Rab3ip
Name: RAB3A interacting protein
Synonyms: SSX2 interacting protein, Rabin3, Gtpat12
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216363
VEGA: 10
Homologene: 32340
Lmnb2
Name: lamin B2
Synonyms: lamin B3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 16907
HGNC: HGNC:6638
Homologene: 7818
Slc6a11
Name: solute carrier family 6 (neurotransmitter transporter, GABA), member 11
Synonyms: E130202I16Rik, D930045G19Rik, Gabt4, GAT4, Gat3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 243616
Homologene: 129935
Muc2
Name: mucin 2
Synonyms: 2010015E03Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17831
HGNC: HGNC:7512
Homologene: 136755
Lpin1
Name: lipin 1
Synonyms: Lipin1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 14245
VEGA: 12
Homologene: 9266
Nxpe2
Name: neurexophilin and PC-esterase domain family, member 2
Synonyms: 4432416J03Rik, Fam55b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 78252
Homologene: 87072
Rbm43
Name: RNA binding motif protein 43
Synonyms: 0610033I05Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71684
Homologene: 12715
Il31ra
Name: interleukin 31 receptor A
Synonyms: GLM-R, GPL
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218624
VEGA: 13
Homologene: 51395
Rpn2
Name: ribophorin II
Synonyms: Rpn-2, 1300012C06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20014
Homologene: 2214
Nelfb
Name: negative elongation factor complex member B
Synonyms: Cobra1, A730008L03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 58202
Homologene: 121600
Emc1
Name: ER membrane protein complex subunit 1
Synonyms: C230096C10Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230866
Homologene: 9002
Tmtc1
Name: transmembrane and tetratricopeptide repeat containing 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 387314
Homologene: 65299
Siglecg
Name: sialic acid binding Ig-like lectin G
Synonyms: mSiglec-G, A630096C01Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243958
Homologene: 13228
Foxn3
Name: forkhead box N3
Synonyms: Ches1l, HTLFL1, Ches1, 5430426H20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 71375
HGNC: HGNC:1928
Homologene: 135955
Fgf17
Name: fibroblast growth factor 17
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 14171
VEGA: 14
HGNC: HGNC:3673
Homologene: 2872
Epb41l4b
Name: erythrocyte membrane protein band 4.1 like 4b
Synonyms: 6430543G08Rik, Epb4.1l4b, Lulu2, Ehm2, D4Ertd346e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 54357
Homologene: 69270
Frmd4b
Name: FERM domain containing 4B
Synonyms: GRSP1, 6030440G05Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232288
Homologene: 14916
Cacna1c
Name: calcium channel, voltage-dependent, L type, alpha 1C subunit
Synonyms: (alpha)1 subunit, Cav1.2, Cchl1a1, L-type Cav1.2, D930026N18Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12288
HGNC: HGNC:1390
Homologene: 55484
Rpgrip1l
Name: Rpgrip1-like
Synonyms: Ftm, Nphp8, 1700047E16Rik, fantom
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244585
Homologene: 18296
Dnah10
Name: dynein, axonemal, heavy chain 10
Synonyms: Dnahc10
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56087
HGNC: HGNC:2941
Homologene: 25816
Dnah2
Name: dynein, axonemal, heavy chain 2
Synonyms: D330014H01Rik, Dnhd3, Dnahc2, 2900022L05Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327954
HGNC: HGNC:2948
Homologene: 72110
Sh3rf1
Name: SH3 domain containing ring finger 1
Synonyms: 2200003J05Rik, Sh3md2, Posh
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 59009
Homologene: 10988
Or5ak24
Name: olfactory receptor family 5 subfamily AK member 24
Synonyms: MOR203-4, GA_x6K02T2Q125-46907515-46906571, Olfr994
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258425
Homologene: 17245
Serpinb9h
Name: serine (or cysteine) peptidase inhibitor, clade B, member 9h
Synonyms: Gm11397
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 544923
HGNC: HGNC:8955
Homologene: 69093
Arhgap29
Name: Rho GTPase activating protein 29
Synonyms: 6720461J18Rik, Parg1, B130017I01Rik, C76601
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 214137
Homologene: 3539
Mast3
Name: microtubule associated serine/threonine kinase 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 546071
Homologene: 66191
Lrrc37
Name: leucine rich repeat containing 37
Synonyms: LOC380730, Gm884
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380730
Homologene: 134511
Gucy2g
Name: guanylate cyclase 2g
Synonyms: GC-G, 2410077I05Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73707
Homologene: 44544
Mettl2
Name: methyltransferase 2, methylcytidine
Synonyms: PSENIP1, 2810438F06Rik, D11Ertd768e, C130031G21Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52686
Homologene: 10174
Pde4dip
Name: phosphodiesterase 4D interacting protein (myomegalin)
Synonyms: Usmg4, 9430063L05Rik, D130016K21Rik, 4732458A06Rik, D3Bwg1078e
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 83679
Homologene: 66961
Gdap1l1
Name: ganglioside-induced differentiation-associated protein 1-like 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228858
HGNC: HGNC:4213
Homologene: 11426
Pla2r1
Name: phospholipase A2 receptor 1
Synonyms: PLA2-I receptor, Pla2g1br, M-type receptor
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18779
HGNC: HGNC:9042
Homologene: 32016
Dlec1
Name: deleted in lung and esophageal cancer 1
Synonyms: D630005C06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 320256
HGNC: HGNC:2899
Homologene: 84733
Psg23
Name: pregnancy-specific beta-1-glycoprotein 23
Synonyms: 1620401C02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56868
HGNC: HGNC:1819
Homologene: 110989
Mypn
Name: myopalladin
Synonyms: 1110056A04Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 68802
VEGA: 10
Homologene: 23778
Plch2
Name: phospholipase C, eta 2
Synonyms: PLCeta2, A930027K05Rik, Plcl4
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269615
Homologene: 85172
Pde6c
Name: phosphodiesterase 6C, cGMP specific, cone, alpha prime
Synonyms: cpfl1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 110855
VEGA: 19
HGNC: HGNC:8787
Homologene: 4521
Nin
Name: ninein
Synonyms: 3110068G20Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 18080
Homologene: 40632
Spock1
Name: sparc/osteonectin, cwcv and kazal-like domains proteoglycan 1
Synonyms: Ticn1, testican 1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20745
Homologene: 80193
Xaf1
Name: XIAP associated factor 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 327959
Homologene: 49488
Qrfpr
Name: pyroglutamylated RFamide peptide receptor
Synonyms: AQ27, Gpr103
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229214
Homologene: 18865
Rsph6a
Name: radial spoke head 6 homolog A (Chlamydomonas)
Synonyms: RSP4, Rshl1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 83434
Homologene: 36476
Or4a39
Name: olfactory receptor family 4subfamily A member 39
Synonyms: GA_x6K02T2Q125-50849945-50848998, Olfr1238, MOR231-11
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258786
Homologene: 128093
Mospd3
Name: motile sperm domain containing 3
Synonyms: Gtig2, 1190005J19Rik, R124, 5133401H10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68929
Homologene: 11406
Tas2r115
Name: taste receptor, type 2, member 115
Synonyms: T2R15, Tas2r15, mGR15, mt2r49
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 353325
Vav3
Name: vav 3 oncogene
Synonyms: Idd18.1, A530094I06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 57257
Homologene: 38143
Tmem132a
Name: transmembrane protein 132A
Synonyms: Hspa5bp1, 6720481D13Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 98170
Homologene: 75076
Papss1
Name: 3'-phosphoadenosine 5'-phosphosulfate synthase 1
Synonyms: SK1, Asapk
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 23971
HGNC: HGNC:8603
Homologene: 81740
Cyp2a12
Name: cytochrome P450, family 2, subfamily a, polypeptide 12
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13085
Homologene: 69128
Tox2
Name: TOX high mobility group box family member 2
Synonyms: RxHMG1, LOC269389
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269389
Homologene: 13155
Afg1l
Name: AFG1 like ATPase
Synonyms: Lace1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 215951
Homologene: 5782
Cbx2
Name: chromobox 2
Synonyms: M33
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 12416
HGNC: HGNC:1552
Homologene: 7256
Sesn1
Name: sestrin 1
Synonyms: SEST1, 1110002G11Rik, PA26
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 140742
Homologene: 8697
Zfp51
Name: zinc finger protein 51
Synonyms: Zfp-51, zfec12
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22709
VEGA: 17
Homologene: 134003
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to T, chromosome 2 at 25,204,280 bp
  • A to G, chromosome 2 at 51,934,918 bp
  • A to T, chromosome 2 at 60,425,447 bp
  • T to A, chromosome 2 at 85,430,275 bp
  • A to G, chromosome 2 at 89,406,297 bp
  • C to T, chromosome 2 at 157,283,647 bp
  • T to C, chromosome 2 at 163,225,561 bp
  • T to C, chromosome 2 at 163,438,588 bp
  • A to G, chromosome 3 at 36,221,950 bp
  • T to C, chromosome 3 at 86,126,685 bp
  • T to G, chromosome 3 at 87,979,762 bp
  • C to T, chromosome 3 at 88,981,987 bp
  • T to C, chromosome 3 at 88,984,222 bp
  • T to C, chromosome 3 at 97,694,069 bp
  • C to T, chromosome 3 at 109,506,406 bp
  • T to A, chromosome 3 at 122,014,600 bp
  • C to A, chromosome 3 at 131,619,056 bp
  • A to T, chromosome 4 at 57,041,064 bp
  • T to C, chromosome 4 at 139,367,163 bp
  • T to C, chromosome 4 at 155,000,519 bp
  • T to C, chromosome 5 at 124,762,173 bp
  • C to T, chromosome 5 at 137,600,608 bp
  • A to C, chromosome 6 at 97,292,373 bp
  • A to T, chromosome 6 at 114,225,847 bp
  • G to T, chromosome 6 at 118,638,505 bp
  • A to T, chromosome 6 at 132,737,364 bp
  • A to T, chromosome 6 at 148,336,251 bp
  • T to G, chromosome 7 at 18,614,735 bp
  • A to T, chromosome 7 at 19,065,325 bp
  • T to C, chromosome 7 at 27,036,519 bp
  • T to C, chromosome 7 at 43,411,625 bp
  • T to A, chromosome 7 at 141,700,489 bp
  • C to A, chromosome 8 at 61,349,459 bp
  • A to T, chromosome 8 at 70,796,717 bp
  • T to C, chromosome 8 at 91,287,675 bp
  • A to T, chromosome 9 at 48,339,572 bp
  • G to T, chromosome 9 at 119,124,184 bp
  • C to T, chromosome 10 at 41,810,839 bp
  • G to A, chromosome 10 at 42,318,641 bp
  • T to G, chromosome 10 at 63,148,115 bp
  • T to C, chromosome 10 at 80,904,257 bp
  • G to A, chromosome 10 at 116,939,405 bp
  • G to T, chromosome 11 at 69,429,398 bp
  • A to G, chromosome 11 at 72,306,593 bp
  • G to T, chromosome 11 at 78,530,139 bp
  • A to T, chromosome 11 at 94,443,220 bp
  • A to G, chromosome 11 at 103,616,739 bp
  • T to C, chromosome 11 at 105,130,448 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • C to T, chromosome 11 at 116,545,383 bp
  • C to T, chromosome 11 at 119,029,088 bp
  • T to C, chromosome 12 at 16,573,714 bp
  • T to A, chromosome 12 at 70,030,012 bp
  • T to C, chromosome 12 at 87,336,065 bp
  • C to T, chromosome 12 at 99,388,836 bp
  • T to A, chromosome 12 at 102,492,217 bp
  • T to C, chromosome 13 at 33,397,798 bp
  • A to T, chromosome 13 at 57,423,143 bp
  • T to C, chromosome 13 at 112,524,094 bp
  • A to G, chromosome 14 at 70,616,094 bp
  • A to G, chromosome 14 at 70,636,996 bp
  • A to G, chromosome 15 at 76,173,075 bp
  • A to C, chromosome 16 at 13,412,228 bp
  • A to T, chromosome 17 at 12,915,695 bp
  • T to A, chromosome 17 at 21,464,398 bp
  • C to T, chromosome 17 at 31,603,255 bp
  • T to A, chromosome 17 at 63,921,772 bp
  • T to C, chromosome 18 at 5,766,716 bp
  • T to C, chromosome 18 at 12,929,036 bp
  • G to T, chromosome 19 at 10,866,471 bp
  • G to A, chromosome 19 at 38,178,121 bp
  • C to T, chromosome 19 at 41,055,781 bp
  • A to T, chromosome 19 at 55,233,165 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9085 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068904-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.