Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9094Btlr/Mmmh
Stock Number:
068909-MU
Citation ID:
RRID:MMRRC_068909-MU
Other Names:
R9094 (G1)
Major Collection:

Strain Information

Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Npy5r
Name: neuropeptide Y receptor Y5
Synonyms: Y5R
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18168
HGNC: HGNC:7958
Homologene: 21241
Mllt1
Name: myeloid/lymphoid or mixed-lineage leukemia; translocated to, 1
Synonyms: BAM11, LTG19, ENL
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 64144
VEGA: 17
HGNC: HGNC:7134
Homologene: 4339
Rgs3
Name: regulator of G-protein signaling 3
Synonyms: 4930506N09Rik, C2pa, PDZ-RGS3, RGS3S, C2PA-RGS3
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 50780
HGNC: HGNC:9999
Homologene: 32440
Ldlrad3
Name: low density lipoprotein receptor class A domain containing 3
Synonyms: Lrad3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241576
Homologene: 18377
Luzp1
Name: leucine zipper protein 1
Synonyms: Luzp, 2700072H04Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 269593
Homologene: 11545
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • C to A, chromosome 1 at 131,802,743 bp
  • T to A, chromosome 1 at 154,479,318 bp
  • T to A, chromosome 1 at 161,105,485 bp
  • T to A, chromosome 2 at 29,067,068 bp
  • C to T, chromosome 2 at 45,113,124 bp
  • A to G, chromosome 2 at 88,339,904 bp
  • T to C, chromosome 2 at 102,057,981 bp
  • A to C, chromosome 2 at 156,079,160 bp
  • C to T, chromosome 2 at 164,597,325 bp
  • T to C, chromosome 2 at 174,424,068 bp
  • A to T, chromosome 4 at 62,582,003 bp
  • T to C, chromosome 4 at 108,780,547 bp
  • T to C, chromosome 4 at 118,385,454 bp
  • GCCAGATGCGCCCA to GCCAGATGCGCCCAGATGCGCCCA, chromosome 4 at 127,326,665 bp
  • A to T, chromosome 4 at 136,545,251 bp
  • C to A, chromosome 4 at 156,168,807 bp
  • T to A, chromosome 5 at 28,073,572 bp
  • A to G, chromosome 5 at 36,469,479 bp
  • T to G, chromosome 5 at 150,552,305 bp
  • GAT to GATCAT, chromosome 6 at 4,756,449 bp
  • G to A, chromosome 6 at 28,830,207 bp
  • G to T, chromosome 6 at 30,574,394 bp
  • A to T, chromosome 6 at 83,151,037 bp
  • T to C, chromosome 6 at 97,421,598 bp
  • C to T, chromosome 6 at 123,828,432 bp
  • G to C, chromosome 7 at 29,184,727 bp
  • T to C, chromosome 7 at 35,203,757 bp
  • T to A, chromosome 7 at 80,238,468 bp
  • T to C, chromosome 7 at 83,652,351 bp
  • G to GACGGCGGCC, chromosome 7 at 97,579,909 bp
  • T to C, chromosome 7 at 102,494,361 bp
  • G to A, chromosome 8 at 66,680,908 bp
  • A to G, chromosome 8 at 70,820,647 bp
  • A to C, chromosome 8 at 117,133,178 bp
  • G to A, chromosome 8 at 121,554,397 bp
  • A to G, chromosome 9 at 22,337,987 bp
  • A to T, chromosome 9 at 42,063,754 bp
  • A to G, chromosome 9 at 57,834,044 bp
  • T to A, chromosome 9 at 108,110,853 bp
  • A to T, chromosome 10 at 39,824,813 bp
  • GCCC to GCC, chromosome 10 at 58,231,122 bp
  • A to G, chromosome 10 at 62,559,258 bp
  • A to G, chromosome 10 at 80,543,020 bp
  • T to C, chromosome 10 at 88,775,318 bp
  • T to A, chromosome 10 at 128,151,238 bp
  • T to C, chromosome 11 at 35,827,355 bp
  • C to T, chromosome 11 at 70,772,415 bp
  • G to A, chromosome 11 at 77,974,295 bp
  • G to T, chromosome 12 at 4,295,494 bp
  • T to A, chromosome 12 at 98,518,516 bp
  • A to G, chromosome 13 at 78,163,606 bp
  • A to T, chromosome 14 at 7,987,306 bp
  • A to C, chromosome 14 at 16,280,721 bp
  • A to G, chromosome 14 at 18,893,288 bp
  • T to C, chromosome 14 at 26,416,200 bp
  • G to A, chromosome 14 at 32,660,657 bp
  • C to G, chromosome 14 at 47,530,471 bp
  • A to T, chromosome 15 at 82,172,774 bp
  • A to T, chromosome 16 at 18,151,844 bp
  • A to G, chromosome 16 at 56,636,227 bp
  • T to C, chromosome 17 at 21,722,951 bp
  • C to A, chromosome 17 at 24,181,300 bp
  • C to A, chromosome 17 at 56,905,737 bp
  • T to C, chromosome 18 at 15,062,312 bp
  • T to A, chromosome 18 at 36,968,540 bp
  • A to G, chromosome 19 at 40,994,039 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9094 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068909-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.