Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9095Btlr/Mmmh
Stock Number:
068910-MU
Citation ID:
RRID:MMRRC_068910-MU
Other Names:
R9095 (G1)
Major Collection:

Strain Information

Arhgef7
Name: Rho guanine nucleotide exchange factor
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54126
Homologene: 2895
Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Ly6a
Name: lymphocyte antigen 6 family member A
Synonyms: Sca-1, TAP, Ly-6A/E, Ly-6E.1, Ly-6A.2, Sca1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110454
Homologene: 113718
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 36,547,160 bp
  • C to A, chromosome 1 at 66,506,753 bp
  • A to C, chromosome 1 at 71,607,990 bp
  • T to C, chromosome 1 at 95,591,800 bp
  • A to T, chromosome 1 at 156,524,643 bp
  • A to T, chromosome 1 at 161,020,371 bp
  • T to C, chromosome 1 at 180,696,837 bp
  • A to G, chromosome 2 at 20,778,153 bp
  • A to G, chromosome 2 at 28,024,653 bp
  • T to G, chromosome 2 at 91,712,635 bp
  • T to A, chromosome 2 at 121,925,615 bp
  • T to A, chromosome 2 at 156,076,290 bp
  • T to A, chromosome 2 at 176,721,252 bp
  • G to T, chromosome 3 at 100,004,776 bp
  • A to T, chromosome 3 at 103,645,938 bp
  • A to G, chromosome 3 at 109,112,088 bp
  • A to G, chromosome 3 at 122,173,907 bp
  • A to T, chromosome 4 at 45,949,466 bp
  • A to G, chromosome 4 at 141,316,701 bp
  • T to A, chromosome 4 at 141,692,279 bp
  • T to C, chromosome 4 at 143,615,190 bp
  • C to A, chromosome 4 at 144,068,358 bp
  • A to C, chromosome 5 at 65,031,390 bp
  • C to T, chromosome 5 at 134,503,400 bp
  • C to T, chromosome 5 at 140,302,986 bp
  • C to T, chromosome 5 at 144,797,151 bp
  • T to A, chromosome 6 at 41,033,104 bp
  • G to A, chromosome 6 at 59,210,524 bp
  • A to G, chromosome 6 at 84,179,684 bp
  • T to A, chromosome 6 at 108,387,391 bp
  • C to T, chromosome 6 at 136,857,271 bp
  • G to T, chromosome 7 at 16,183,839 bp
  • T to A, chromosome 7 at 27,131,242 bp
  • A to T, chromosome 7 at 34,257,345 bp
  • C to A, chromosome 7 at 37,963,448 bp
  • G to A, chromosome 7 at 45,045,843 bp
  • C to T, chromosome 7 at 45,541,068 bp
  • G to A, chromosome 7 at 49,604,545 bp
  • T to C, chromosome 7 at 50,856,402 bp
  • T to C, chromosome 7 at 65,302,997 bp
  • C to T, chromosome 7 at 67,004,369 bp
  • C to A, chromosome 7 at 102,742,266 bp
  • A to G, chromosome 7 at 102,984,480 bp
  • A to T, chromosome 7 at 127,610,375 bp
  • T to G, chromosome 7 at 140,667,900 bp
  • T to C, chromosome 8 at 11,785,819 bp
  • AAGAATATATTCTACAGAATATA to AAGAATATA, chromosome 8 at 69,303,096 bp
  • G to A, chromosome 8 at 121,554,397 bp
  • G to A, chromosome 9 at 107,791,890 bp
  • T to C, chromosome 9 at 108,914,661 bp
  • A to G, chromosome 10 at 13,253,642 bp
  • GCCC to GCC, chromosome 10 at 58,231,122 bp
  • A to T, chromosome 10 at 63,322,298 bp
  • T to C, chromosome 10 at 88,775,318 bp
  • T to G, chromosome 10 at 93,011,020 bp
  • T to C, chromosome 10 at 127,507,715 bp
  • A to G, chromosome 11 at 70,771,579 bp
  • G to A, chromosome 11 at 77,974,295 bp
  • C to T, chromosome 11 at 99,634,975 bp
  • T to G, chromosome 11 at 105,867,278 bp
  • A to G, chromosome 12 at 58,212,834 bp
  • C to A, chromosome 12 at 114,357,874 bp
  • G to T, chromosome 13 at 89,704,525 bp
  • T to A, chromosome 13 at 94,233,090 bp
  • A to T, chromosome 15 at 74,995,484 bp
  • A to G, chromosome 15 at 75,597,792 bp
  • T to A, chromosome 16 at 32,614,753 bp
  • T to A, chromosome 16 at 96,153,044 bp
  • C to T, chromosome 17 at 24,281,396 bp
  • C to A, chromosome 17 at 28,715,439 bp
  • A to G, chromosome 18 at 20,390,225 bp
  • A to T, chromosome 18 at 37,762,999 bp
  • A to G, chromosome 18 at 61,820,392 bp
  • G to A, chromosome 18 at 69,465,393 bp
  • T to A, chromosome 19 at 10,867,048 bp
  • T to G, chromosome 19 at 13,165,946 bp
  • T to C, chromosome 19 at 34,594,499 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9095 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068910-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.