Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9095Btlr/Mmmh
Stock Number:
068910-MU
Citation ID:
RRID:MMRRC_068910-MU
Other Names:
R9095 (G1)
Major Collection:

Strain Information

Arhgef7
Name: Rho guanine nucleotide exchange factor
Synonyms: Cool, PIX, Pak interacting exchange factor, p85SPR, betaPix-c, betaPix-b, cool-1, betaPix
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 54126
Homologene: 2895
Epha2
Name: Eph receptor A2
Synonyms: Sek-2, Eck, Sek2, Myk2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13836
HGNC: HGNC:3386
Homologene: 20929
Vcan
Name: versican
Synonyms: PG-M, hdf, heart defect, 5430420N07Rik, Cspg2, DPEAAE
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13003
HGNC: HGNC:2464
Homologene: 3228
Ly6a
Name: lymphocyte antigen 6 family member A
Synonyms: Sca-1, TAP, Ly-6A/E, Ly-6E.1, Ly-6A.2, Sca1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110454
Homologene: 113718
Sez6
Name: seizure related gene 6
Synonyms: sez-6, D11Bhm177e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20370
Homologene: 10948
Mad1l1
Name: MAD1 mitotic arrest deficient 1-like 1
Synonyms: Mad1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 17120
HGNC: HGNC:6762
Homologene: 74500
Uri1
Name: URI1, prefoldin-like chaperone
Synonyms: NNX3, Rmp, C80913
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19777
Homologene: 2813
Utp20
Name: UTP20 small subunit processome component
Synonyms: mDRIM, DRIM, 3830408P06Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70683
VEGA: 10
Homologene: 38373
Mapk14
Name: mitogen-activated protein kinase 14
Synonyms: p38-alpha, p38, p38 MAP Kinase, Mxi2, CSBP2, Crk1, Csbp1, p38MAPK, p38a, p38 alpha, p38alpha, p38 MAP kinase alpha, p38 MAPK
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 26416
HGNC: HGNC:6876
Homologene: 31777
Sirt1
Name: sirtuin 1
Synonyms: Sir2, Sir2alpha
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 93759
Homologene: 56556
Rbm6
Name: RNA binding motif protein 6
Synonyms: NY-LU-12, g16, Def-3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 19654
HGNC: HGNC:9903
Homologene: 31336
Fbxo31
Name: F-box protein 31
Synonyms: 2310046N15Rik, Fbx14, Fbxo14, 1110003O08Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Etl4
Name: enhancer trap locus 4
Synonyms: Etl-4, E330027G05Rik, 6620402G01Rik, 9430077C05Rik, Skt, Sickle tail
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 208618
Homologene: 10477
Cpne1
Name: copine I
Synonyms: 1810028N16Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 266692
HGNC: HGNC:2314
Homologene: 36501
Trrap
Name: transformation/transcription domain-associated protein
Synonyms: transactivation/transformation-domain associated protein
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100683
Homologene: 39246
Nav2
Name: neuron navigator 2
Synonyms: POMFIL2, Unc53H2, HELAD1, RAINB2, 5330421F07Rik, Rainb1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 78286
Homologene: 52330
Tanc2
Name: tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2
Synonyms: 5730590C14Rik, 3526402J09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 77097
Homologene: 64680
Itpr1
Name: inositol 1,4,5-trisphosphate receptor 1
Synonyms: P400, IP3R1, Itpr-1, Ip3r, Pcp-1, opt, InsP3R type I, Pcp1, wblo
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16438
HGNC: HGNC:6180
Homologene: 1673
Tcf4
Name: transcription factor 4
Synonyms: SEF-2, ITF-2, MITF-2B, MITF-2A, ME2, E2.2, TFE, E2-2, SEF2-1, ASP-I2, ITF-2b, 5730422P05Rik, bHLHb19
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 21413
Homologene: 2407
Tfrc
Name: transferrin receptor
Synonyms: CD71, Mtvr-1, Mtvr1, E430033M20Rik, 2610028K12Rik, p90, Trfr, TfR1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 22042
Homologene: 2429
Tjp1
Name: tight junction protein 1
Synonyms: ZO-1, ZO1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21872
Homologene: 2445
Ddi2
Name: DNA-damage inducible protein 2
Synonyms: 9130022E05Rik, 1110056G13Rik, 1700027M01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 68817
Homologene: 121661
Csnk2a1-ps3
Name: casein kinase 2, alpha 1 polypeptide, pseudogene 3
Synonyms: Gm10031, Csnk2a3, Csnk2a1-rs3
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 100039026
Abca17
Name: ATP-binding cassette, sub-family A member 17
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381072
Homologene: 86807
Gpihbp1
Name: GPI-anchored HDL-binding protein 1
Synonyms: GPI-HBP1, 1110002J19Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 68453
Homologene: 136164
Or51e2
Name: olfactory receptor family 51 subfamily E member 2
Synonyms: RA1c, PSGR, MOL2.3, 4633402A21Rik, MOR18-2, GA_x6K02T2PBJ9-5459657-5458695, Olfr78
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 170639
Homologene: 23713
Golm2
Name: golgi membrane protein 2
Synonyms: D130060C09Rik, Casc4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 319996
Homologene: 16310
Atg4a-ps
Name: autophagy related 4A, pseudogene
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 102926
Nell1
Name: NEL-like 1
Synonyms: B230343H07Rik, l7R6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 338352
HGNC: HGNC:7750
Homologene: 4486
Abca4
Name: ATP-binding cassette, sub-family A member 4
Synonyms: Rim protein, RmP, Abc10, D430003I15Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 11304
HGNC: HGNC:34
Homologene: 298
Garre1
Name: granule associated Rac and RHOG effector 1
Synonyms: 4931406P16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233103
Homologene: 8795
Pcdhgb8
Name: protocadherin gamma subfamily B, 8
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93705
HGNC: HGNC:8715
Homologene: 81868
Unc80
Name: unc-80, NALCN activator
Synonyms: C230061B10Rik, C030018G13Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329178
Homologene: 122243
Pramel4
Name: PRAME like 4
Synonyms: D4Ertd792e
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 347710
Homologene: 133722
Sstr1
Name: somatostatin receptor 1
Synonyms: sst1, Smstr-1, Smstr1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 20605
Homologene: 820
Zfp629
Name: zinc finger protein 629
Synonyms: 9330199A09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320683
Homologene: 65318
Tigd2
Name: tigger transposable element derived 2
Synonyms: 3632410O17Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68140
Homologene: 129603
Ccdc180
Name: coiled-coil domain containing 180
Synonyms: LOC381522, E230008N13Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 381522
Homologene: 117988
Stac3
Name: SH3 and cysteine rich domain 3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 237611
Homologene: 17039
Tmem89
Name: transmembrane protein 89
Synonyms: 1700024B07Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69384
Homologene: 52857
Scamp1
Name: secretory carrier membrane protein 1
Synonyms: 4930505M11Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 107767
Homologene: 37975
Dsg1b
Name: desmoglein 1 beta
Synonyms: Dsg5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 225256
HGNC: HGNC:3048
Homologene: 1463
Plekha4
Name: pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4
Synonyms: PEPP1, 2410005C22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69217
Homologene: 10848
Or5b107
Name: olfactory receptor family 5 subfamily B member 107
Synonyms: GA_x6K02T2RE5P-3491834-3492772, MOR202-35, Olfr1461
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258299
HGNC: HGNC:8324
Homologene: 128112
Spag17
Name: sperm associated antigen 17
Synonyms: 4931427F14Rik, PF6
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74362
Homologene: 52601
Col5a1
Name: collagen, type V, alpha 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12831
HGNC: HGNC:2209
Homologene: 55434
Ablim3
Name: actin binding LIM protein family, member 3
Synonyms: D930036B08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 319713
VEGA: 18
Homologene: 69175
Zfp781a
Name: zinc finger protein 781A
Synonyms: D130040H23Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 211135
Homologene: 138403
Zbtb37
Name: zinc finger and BTB domain containing 37
Synonyms: D430004I08Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240869
Homologene: 13048
Clip2
Name: CAP-GLY domain containing linker protein 2
Synonyms: CLIP-115, WSCR4, Cyln2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269713
HGNC: HGNC:2586
Homologene: 20718
St8sia4
Name: ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4
Synonyms: ST8SiaIV, PST, PST-1, Siat8d
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 20452
Homologene: 4147
Adamts17
Name: ADAM metallopeptidase with thrombospondin type 1 motif 17
Synonyms: AU023434
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233332
Homologene: 16373
Get1
Name: guided entry of tail-anchored proteins factor 1
Synonyms: C030018G21Rik, Chd5, 5530402J05Rik, Wrb
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 71446
Homologene: 37945
Prss3b
Name: serine protease 3B
Synonyms: 2210010C04Rik, T7, cationic trypsinogen (isoform T7)
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 67373
Homologene: 134055
Ifit1bl1
Name: interferon induced protein with tetratricpeptide repeats 1B like 1
Synonyms: Gm14446
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 667373
Homologene: 78213
Mixl1
Name: Mix paired-like homeobox
Synonyms: Mml
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27217
Homologene: 8445
Cyp2f2
Name: cytochrome P450, family 2, subfamily f, polypeptide 2
Synonyms: Cyp2f
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 13107
Homologene: 73898
Slc25a54
Name: solute carrier family 25, member 54
Synonyms: SCaMC-1like, 4930443G12Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74686
Homologene: 82464
Tmem132a
Name: transmembrane protein 132A
Synonyms: 6720481D13Rik, Hspa5bp1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 98170
Homologene: 75076
Harbi1
Name: harbinger transposase derived 1
Synonyms: D230010M03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241547
Homologene: 24535
Or13a25
Name: olfactory receptor family 13 subfamily A member 25
Synonyms: GA_x6K02T2PBJ9-42813436-42814368, MOR253-4, Olfr539
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258963
Homologene: 79393
Zfp3
Name: zinc finger protein 3
Synonyms: Fnp-1, Zfp-3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 193043
Homologene: 27406
Or51g1
Name: olfactory receptor family 51 subfamily G member 1
Synonyms: GA_x6K02T2PBJ9-5696486-5695545, MOR7-1, Olfr578
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259119
Homologene: 17513
Fam114a1
Name: family with sequence similarity 114, member A1
Synonyms: 1190001N04Rik, 9130005N14Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68303
Homologene: 12259
Art4
Name: ADP-ribosyltransferase 4
Synonyms: 4432404K01Rik, DO, DOK1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 109978
HGNC: HGNC:726
Homologene: 10883
Ankrd39
Name: ankyrin repeat domain 39
Synonyms: C030004B10Rik, 9130416N05Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 109346
Homologene: 9519
Cfap54
Name: cilia and flagella associated protein 54
Synonyms: LOC380653, Gm872, 4930485B16Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 380654
Homologene: 133438
Ighv13-2
Name: immunoglobulin heavy variable 13-2
Synonyms: Gm15449
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 629842
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 36,547,160 bp
  • C to A, chromosome 1 at 66,506,753 bp
  • A to C, chromosome 1 at 71,607,990 bp
  • T to C, chromosome 1 at 95,591,800 bp
  • A to T, chromosome 1 at 156,524,643 bp
  • A to T, chromosome 1 at 161,020,371 bp
  • T to C, chromosome 1 at 180,696,837 bp
  • A to G, chromosome 2 at 20,778,153 bp
  • A to G, chromosome 2 at 28,024,653 bp
  • T to G, chromosome 2 at 91,712,635 bp
  • T to A, chromosome 2 at 121,925,615 bp
  • T to A, chromosome 2 at 156,076,290 bp
  • T to A, chromosome 2 at 176,721,252 bp
  • G to T, chromosome 3 at 100,004,776 bp
  • A to T, chromosome 3 at 103,645,938 bp
  • A to G, chromosome 3 at 109,112,088 bp
  • A to G, chromosome 3 at 122,173,907 bp
  • A to T, chromosome 4 at 45,949,466 bp
  • A to G, chromosome 4 at 141,316,701 bp
  • T to A, chromosome 4 at 141,692,279 bp
  • T to C, chromosome 4 at 143,615,190 bp
  • C to A, chromosome 4 at 144,068,358 bp
  • A to C, chromosome 5 at 65,031,390 bp
  • C to T, chromosome 5 at 134,503,400 bp
  • C to T, chromosome 5 at 140,302,986 bp
  • C to T, chromosome 5 at 144,797,151 bp
  • T to A, chromosome 6 at 41,033,104 bp
  • G to A, chromosome 6 at 59,210,524 bp
  • A to G, chromosome 6 at 84,179,684 bp
  • T to A, chromosome 6 at 108,387,391 bp
  • C to T, chromosome 6 at 136,857,271 bp
  • G to T, chromosome 7 at 16,183,839 bp
  • T to A, chromosome 7 at 27,131,242 bp
  • A to T, chromosome 7 at 34,257,345 bp
  • C to A, chromosome 7 at 37,963,448 bp
  • G to A, chromosome 7 at 45,045,843 bp
  • C to T, chromosome 7 at 45,541,068 bp
  • G to A, chromosome 7 at 49,604,545 bp
  • T to C, chromosome 7 at 50,856,402 bp
  • T to C, chromosome 7 at 65,302,997 bp
  • C to T, chromosome 7 at 67,004,369 bp
  • C to A, chromosome 7 at 102,742,266 bp
  • A to G, chromosome 7 at 102,984,480 bp
  • A to T, chromosome 7 at 127,610,375 bp
  • T to G, chromosome 7 at 140,667,900 bp
  • T to C, chromosome 8 at 11,785,819 bp
  • AAGAATATATTCTACAGAATATA to AAGAATATA, chromosome 8 at 69,303,096 bp
  • G to A, chromosome 8 at 121,554,397 bp
  • G to A, chromosome 9 at 107,791,890 bp
  • T to C, chromosome 9 at 108,914,661 bp
  • A to G, chromosome 10 at 13,253,642 bp
  • GCCC to GCC, chromosome 10 at 58,231,122 bp
  • A to T, chromosome 10 at 63,322,298 bp
  • T to C, chromosome 10 at 88,775,318 bp
  • T to G, chromosome 10 at 93,011,020 bp
  • T to C, chromosome 10 at 127,507,715 bp
  • A to G, chromosome 11 at 70,771,579 bp
  • G to A, chromosome 11 at 77,974,295 bp
  • C to T, chromosome 11 at 99,634,975 bp
  • T to G, chromosome 11 at 105,867,278 bp
  • A to G, chromosome 12 at 58,212,834 bp
  • C to A, chromosome 12 at 114,357,874 bp
  • G to T, chromosome 13 at 89,704,525 bp
  • T to A, chromosome 13 at 94,233,090 bp
  • A to T, chromosome 15 at 74,995,484 bp
  • A to G, chromosome 15 at 75,597,792 bp
  • T to A, chromosome 16 at 32,614,753 bp
  • T to A, chromosome 16 at 96,153,044 bp
  • C to T, chromosome 17 at 24,281,396 bp
  • C to A, chromosome 17 at 28,715,439 bp
  • A to G, chromosome 18 at 20,390,225 bp
  • A to T, chromosome 18 at 37,762,999 bp
  • A to G, chromosome 18 at 61,820,392 bp
  • G to A, chromosome 18 at 69,465,393 bp
  • T to A, chromosome 19 at 10,867,048 bp
  • T to G, chromosome 19 at 13,165,946 bp
  • T to C, chromosome 19 at 34,594,499 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9095 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068910-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.