Strain Name:
C57BL/6J-MtgxR9098Btlr/Mmmh
Stock Number:
068913-MU
Citation ID:
RRID:MMRRC_068913-MU
Other Names:
R9098 (G1)
Major Collection:

Strain Information

Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Mkl2, Mrtfb, Gt4-1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Syt6
Name: synaptotagmin VI
Synonyms: 3110037A08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54524
Homologene: 10301
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Htr1b
Name: 5-hydroxytryptamine (serotonin) receptor 1B
Synonyms: 5-HT1B receptor, 5-HT1B receptor, 5HT1B receptor
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15551
HGNC: HGNC:5287
Homologene: 669
Atp6v1h
Name: ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms: 0710001F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108664
Homologene: 7139
Rxra
Name: retinoid X receptor alpha
Synonyms: RXRalpha1, RXR alpha 1, 9530071D11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20181
Homologene: 2220
Ubap2l
Name: ubiquitin-associated protein 2-like
Synonyms: 3110083O19Rik, 4932431F02Rik, A430103N23Rik, NICE-4
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74383
Homologene: 136291
Fbxo31
Name: F-box protein 31
Synonyms: Fbx14, 1110003O08Rik, 2310046N15Rik, Fbxo14
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76454
Homologene: 11684
Schip1
Name: schwannomin interacting protein 1
Synonyms: SCHIP-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 30953
Homologene: 130673
Armc8
Name: armadillo repeat containing 8
Synonyms: 1200015K23Rik, Gid5, HSPC056
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74125
Homologene: 9121
Lpar6
Name: lysophosphatidic acid receptor 6
Synonyms: 2610302I02Rik, P2y5, P2ry5
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 67168
Homologene: 55925
Palm
Name: paralemmin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18483
VEGA: 10
HGNC: HGNC:8594
Homologene: 1937
Chmp7
Name: charged multivesicular body protein 7
Synonyms: CHMP family, member 7, 4930596K11Rik, 6330407G04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105513
VEGA: 14
Homologene: 14613
Krit1
Name: KRIT1, ankyrin repeat containing
Synonyms: 2010007K12Rik, Ccm1, Krit1, A630036P20Rik, Krit1B, Krit1A
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 79264
HGNC: HGNC:1573
Homologene: 12746
Stx7
Name: syntaxin 7
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 53331
VEGA: 10
Homologene: 37823
Htr2b
Name: 5-hydroxytryptamine (serotonin) receptor 2B
Synonyms: 5-HT2B
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15559
HGNC: HGNC:5294
Homologene: 55492
Muc16
Name: mucin 16
Synonyms: 1110008I14Rik, Gm21044, LOC385009
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73732
Homologene: 141193
Zfy1
Name: zinc finger protein 1, Y-linked
Synonyms: Zfy-1
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22767
Homologene: 56456
Lama1
Name: laminin, alpha 1
Synonyms: Lama
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 16772
VEGA: 17
HGNC: HGNC:6481
Homologene: 21146
Srcap
Name: Snf2-related CREBBP activator protein
Synonyms: D030022P06Rik, F630004O05Rik, B930091H02Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043597
Homologene: 38213
Cd22
Name: CD22 antigen
Synonyms: Lyb8, Lyb-8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12483
HGNC: HGNC:1643
Homologene: 31052
Acat2
Name: acetyl-Coenzyme A acetyltransferase 2
Synonyms: Tcp1-rs1, Tcp-1x
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 110460
HGNC: HGNC:94
Homologene: 55855
Cnbd1
Name: cyclic nucleotide binding domain containing 1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 435772
Homologene: 27843
Dnah5
Name: dynein, axonemal, heavy chain 5
Synonyms: b2b1565Clo, b2b3491Clo, Mdnah5, b2b1154Clo, b2b1537Clo, Dnahc5, b2b1134Clo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 110082
HGNC: HGNC:2950
Homologene: 1048
Abcb4
Name: ATP-binding cassette, sub-family B member 4
Synonyms: Pgy-2, Mdr2, mdr-2, Pgy2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 18670
HGNC: HGNC:45
Homologene: 136368
Rnpep
Name: arginyl aminopeptidase (aminopeptidase B)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 215615
Homologene: 10628
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Lgn1, Birc1e
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Dhx36
Name: DEAH-box helicase 36
Synonyms: 2810407E23Rik, RHAU, Ddx36
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72162
Homologene: 6356
Avl9
Name: AVL9 cell migration associated
Synonyms: D730049P16Rik, 5830411G16Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 78937
Homologene: 62425
Sis
Name: sucrase isomaltase
Synonyms: sucrase-isomaltase, Si-s, 2010204N08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69983
Homologene: 37424
Vmn2r115
Name: vomeronasal 2, receptor 115
Synonyms: V2Rp4, EG638102
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 638102
Homologene: 86604
Mmp3
Name: matrix metallopeptidase 3
Synonyms: Stmy1, SLN1, STR-1, progelatinase, stromelysin-1, Str1, stromelysin 1, SLN-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17392
VEGA: 9
HGNC: HGNC:7173
Homologene: 20545
Rhobtb3
Name: Rho-related BTB domain containing 3
Synonyms: 2610033K01Rik, 4930503C18Rik, 1700040C17Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 73296
Homologene: 8932
Nek11
Name: NIMA (never in mitosis gene a)-related expressed kinase 11
Synonyms: 4932416N14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 208583
Homologene: 57008
Aoc2
Name: amine oxidase copper containing 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237940
HGNC: HGNC:549
Homologene: 56457
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Jkampl
Name: JNK1/MAPK8 associated membrane protein like
Synonyms: 4931417E11Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66740
Homologene: 75225
Ogfr
Name: opioid growth factor receptor
Synonyms: 2010013E17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72075
Homologene: 7199
Fmo9
Name: flavin containing monooxygenase 9
Synonyms: 4831428F09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240894
Homologene: 134192
Gucy1a2
Name: guanylate cyclase 1, soluble, alpha 2
Synonyms: 6330407I18Rik, A230060L24Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 234889
HGNC: HGNC:4684
Homologene: 47953
Ctns
Name: cystinosis, nephropathic
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 83429
HGNC: HGNC:2518
Homologene: 3625
Flnc
Name: filamin C, gamma
Synonyms: 1110055E19Rik, actin binding protein 280, Fln2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 68794
HGNC: HGNC:3756
Homologene: 37481
Mus81
Name: MUS81 structure-specific endonuclease subunit
Synonyms: 1200008A18Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 71711
Homologene: 5725
Megf6
Name: multiple EGF-like-domains 6
Synonyms: Egfl3, 2600001P17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230971
HGNC: HGNC:3232
Homologene: 45412
Or5ak22
Name: olfactory receptor family 5 subfamily AK member 22
Synonyms: MOR203-1, Olfr992, GA_x6K02T2Q125-46877170-46876241
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258865
Homologene: 121517
Pramel22
Name: PRAME like 22
Synonyms: Gm13088
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 277668
Homologene: 129883
Adgrb1
Name: adhesion G protein-coupled receptor B1
Synonyms: Bai1, B830018M07Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 107831
HGNC: HGNC:943
Homologene: 1287
Tnni3k
Name: TNNI3 interacting kinase
Synonyms: Cark, D830019J24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 435766
Homologene: 41084
Nmt2
Name: N-myristoyltransferase 2
Synonyms: hNMT-2, A930001K02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18108
HGNC: HGNC:7858
Homologene: 101539
Nol4l
Name: nucleolar protein 4-like
Synonyms: 8430427H17Rik, LOC381396
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329540
Homologene: 129589
A830018L16Rik
Name: RIKEN cDNA A830018L16 gene
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 320492
Homologene: 14194
Nmur2
Name: neuromedin U receptor 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216749
Homologene: 49618
Or10d4c
Name: olfactory receptor family 10 subfamily D member 4C
Synonyms: GA_x6K02T2PVTD-33343617-33344561, Olfr961, MOR224-5
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 258497
VEGA: 9
Homologene: 74020
Cnnm4
Name: cyclin M4
Synonyms: Acdp4, 5430430O18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 94220
HGNC: HGNC:105
Homologene: 75662
Zfp639
Name: zinc finger protein 639
Synonyms: 6230400O18Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67778
Homologene: 9473
Vmn2r95
Name: vomeronasal 2, receptor 95
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 328759
Homologene: 115024
Adam3
Name: ADAM metallopeptidase domain 3
Synonyms: Taz83, ADAM3, Taz83, tMDC, Cyrn1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11497
HGNC: HGNC:209
Homologene: 69052
Or1o2
Name: olfactory receptor family 1 subfamily O member 2
Synonyms: Olfr97, MOR156-2, GA_x6K02T2PSCP-1672287-1671355
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258505
Homologene: 133051
Kcnmb1
Name: potassium large conductance calcium-activated channel, subfamily M, beta member 1
Synonyms: BKbeta1, BK channel beta subunit
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16533
HGNC: HGNC:6285
Homologene: 3054
Tlr12
Name: toll-like receptor 12
Synonyms: LOC384059, Tlr11
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 384059
Homologene: 135964
Rsl1d1
Name: ribosomal L1 domain containing 1
Synonyms: 2410005K20Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 66409
Homologene: 41052
Cpeb4
Name: cytoplasmic polyadenylation element binding protein 4
Synonyms: 4930447D24Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67579
Homologene: 12736
Ubl7
Name: ubiquitin-like 7 (bone marrow stromal cell-derived)
Synonyms: 2300004C15Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69459
VEGA: 9
Homologene: 12312
Jph2
Name: junctophilin 2
Synonyms: JP-2, 1110002E14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 59091
Homologene: 10714
Btd
Name: biotinidase
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 26363
HGNC: HGNC:1122
Homologene: 37255
Gipr
Name: gastric inhibitory polypeptide receptor
Synonyms: LOC232937, LOC381853, glucose-dependent insulinotropic polypeptide receptor
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 381853
HGNC: HGNC:4271
Homologene: 20081
Tspan4
Name: tetraspanin 4
Synonyms: D130042I01Rik, NAG-2, Tspan-4, novel antigen 2, Tm4sf7
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 64540
Homologene: 2453
Adra1b
Name: adrenergic receptor, alpha 1b
Synonyms: alpha1B-adrenergic receptor
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 11548
HGNC: HGNC:278
Homologene: 55477
Cldn11
Name: claudin 11
Synonyms: oligodendrocyte-specific protein, Osp, Otm
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18417
HGNC: HGNC:8514
Homologene: 4093
Snx18
Name: sorting nexin 18
Synonyms: Snag1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 170625
VEGA: 13
Homologene: 14164
Cmtm1
Name: CKLF-like MARVEL transmembrane domain containing 1
Synonyms: CHLFH1a, Cklfsf1, CKLFH1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 100504164
Homologene: 134399
Ms4a18
Name: membrane-spanning 4-domains, subfamily A, member 18
Synonyms: 5033428B15Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76002
Homologene: 89543
Ankrd31
Name: ankyrin repeat domain 31
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 625662
Homologene: 110355
Naaladl2
Name: N-acetylated alpha-linked acidic dipeptidase-like 2
Synonyms: EG635702, 2810043G22Rik, LOC381500
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 635702
Homologene: 45786
Zscan4-ps1
Name: zinc finger and SCAN domain containing 4, pseudogene 1
Synonyms: EG545912
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 545912
Gm21663
Name: predicted gene, 21663
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 100862349
Homologene: 69402
Cirop
Name: ciliated left-right organizer metallopeptidase
Synonyms: Gm29776
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 101056084
VEGA: 14
Homologene: 131742
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 5,093,415 bp
  • A to T, chromosome 1 at 11,562,987 bp
  • A to G, chromosome 1 at 36,472,089 bp
  • T to C, chromosome 1 at 86,099,759 bp
  • A to T, chromosome 1 at 135,278,821 bp
  • T to C, chromosome 1 at 166,664,630 bp
  • T to A, chromosome 2 at 3,305,278 bp
  • C to T, chromosome 2 at 27,748,744 bp
  • T to C, chromosome 2 at 85,399,651 bp
  • C to A, chromosome 2 at 153,470,710 bp
  • C to T, chromosome 2 at 163,339,553 bp
  • T to A, chromosome 2 at 177,314,563 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 3 at 24,433,180 bp
  • A to G, chromosome 3 at 31,163,127 bp
  • A to G, chromosome 3 at 32,519,736 bp
  • C to A, chromosome 3 at 62,506,720 bp
  • C to A, chromosome 3 at 62,506,721 bp
  • A to G, chromosome 3 at 68,064,985 bp
  • T to A, chromosome 3 at 72,937,245 bp
  • A to G, chromosome 3 at 90,002,449 bp
  • T to C, chromosome 3 at 103,585,579 bp
  • T to C, chromosome 3 at 154,941,677 bp
  • A to T, chromosome 4 at 18,886,061 bp
  • A to G, chromosome 4 at 128,617,077 bp
  • A to T, chromosome 4 at 143,654,527 bp
  • G to A, chromosome 4 at 148,041,625 bp
  • G to A, chromosome 4 at 154,269,703 bp
  • A to C, chromosome 5 at 3,813,135 bp
  • A to T, chromosome 5 at 8,958,441 bp
  • G to C, chromosome 5 at 25,942,169 bp
  • C to T, chromosome 6 at 29,455,519 bp
  • T to C, chromosome 6 at 56,730,643 bp
  • T to C, chromosome 6 at 73,469,534 bp
  • T to A, chromosome 7 at 11,065,568 bp
  • C to T, chromosome 7 at 19,163,570 bp
  • T to C, chromosome 7 at 30,867,966 bp
  • T to C, chromosome 7 at 127,552,644 bp
  • T to C, chromosome 7 at 141,491,903 bp
  • C to T, chromosome 8 at 24,689,468 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • G to A, chromosome 8 at 121,554,397 bp
  • A to T, chromosome 9 at 3,634,489 bp
  • T to A, chromosome 9 at 7,446,936 bp
  • T to A, chromosome 9 at 18,643,679 bp
  • A to G, chromosome 9 at 39,647,083 bp
  • A to G, chromosome 9 at 57,921,752 bp
  • A to T, chromosome 9 at 81,632,428 bp
  • G to A, chromosome 9 at 99,505,309 bp
  • T to A, chromosome 9 at 105,293,657 bp
  • G to A, chromosome 9 at 108,112,974 bp
  • C to T, chromosome 10 at 24,182,826 bp
  • A to G, chromosome 10 at 79,819,154 bp
  • A to T, chromosome 11 at 31,872,679 bp
  • A to G, chromosome 11 at 33,964,806 bp
  • T to C, chromosome 11 at 43,776,391 bp
  • T to C, chromosome 11 at 56,029,582 bp
  • A to G, chromosome 11 at 73,187,735 bp
  • T to C, chromosome 11 at 101,326,338 bp
  • A to G, chromosome 13 at 75,939,583 bp
  • A to G, chromosome 13 at 96,780,371 bp
  • T to C, chromosome 13 at 100,229,619 bp
  • A to G, chromosome 13 at 113,617,774 bp
  • A to G, chromosome 14 at 31,662,276 bp
  • T to G, chromosome 14 at 54,695,229 bp
  • C to A, chromosome 14 at 69,719,462 bp
  • C to T, chromosome 14 at 73,238,793 bp
  • A to G, chromosome 15 at 28,419,961 bp
  • A to G, chromosome 15 at 74,543,340 bp
  • A to G, chromosome 16 at 11,201,363 bp
  • A to G, chromosome 16 at 13,403,189 bp
  • G to A, chromosome 17 at 12,960,092 bp
  • T to A, chromosome 17 at 18,439,905 bp
  • C to A, chromosome 17 at 23,345,829 bp
  • T to C, chromosome 17 at 37,232,070 bp
  • C to T, chromosome 17 at 67,804,513 bp
  • T to A, chromosome 19 at 5,484,004 bp
  • C to A, chromosome 19 at 11,013,377 bp
  • A to G, chromosome Y at 725,987 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9098 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068913-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.