Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9098Btlr/Mmmh
Stock Number:
068913-MU
Citation ID:
RRID:MMRRC_068913-MU
Other Names:
R9098 (G1)
Major Collection:

Strain Information

Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Syt6
Name: synaptotagmin VI
Synonyms: 3110037A08Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 54524
Homologene: 10301
Mthfr
Name: methylenetetrahydrofolate reductase
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17769
HGNC: HGNC:7436
Homologene: 4349
Htr1b
Name: 5-hydroxytryptamine (serotonin) receptor 1B
Synonyms: 5-HT1B receptor, 5HT1B receptor, 5-HT1B receptor
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 15551
HGNC: HGNC:5287
Homologene: 669
Atp6v1h
Name: ATPase, H+ transporting, lysosomal V1 subunit H
Synonyms: 0710001F19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 108664
Homologene: 7139
Rxra
Name: retinoid X receptor alpha
Synonyms: RXRalpha1, RXR alpha 1, 9530071D11Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 20181
Homologene: 2220
Ubap2l
Name: ubiquitin-associated protein 2-like
Synonyms: 3110083O19Rik, NICE-4, 4932431F02Rik, A430103N23Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 74383
Homologene: 136291
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to G, chromosome 1 at 5,093,415 bp
  • A to T, chromosome 1 at 11,562,987 bp
  • A to G, chromosome 1 at 36,472,089 bp
  • T to C, chromosome 1 at 86,099,759 bp
  • A to T, chromosome 1 at 135,278,821 bp
  • T to C, chromosome 1 at 166,664,630 bp
  • T to A, chromosome 2 at 3,305,278 bp
  • C to T, chromosome 2 at 27,748,744 bp
  • T to C, chromosome 2 at 85,399,651 bp
  • C to A, chromosome 2 at 153,470,710 bp
  • C to T, chromosome 2 at 163,339,553 bp
  • T to A, chromosome 2 at 177,314,563 bp
  • GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG to GGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGAGCCAGAGGACCCCAAAAGCCAGGTGGGGCCAGAGGACCCCCAAAGCCAGGTGG, chromosome 2 at 180,595,266 bp
  • A to T, chromosome 3 at 24,433,180 bp
  • A to G, chromosome 3 at 31,163,127 bp
  • A to G, chromosome 3 at 32,519,736 bp
  • C to A, chromosome 3 at 62,506,720 bp
  • C to A, chromosome 3 at 62,506,721 bp
  • A to G, chromosome 3 at 68,064,985 bp
  • T to A, chromosome 3 at 72,937,245 bp
  • A to G, chromosome 3 at 90,002,449 bp
  • T to C, chromosome 3 at 103,585,579 bp
  • T to C, chromosome 3 at 154,941,677 bp
  • A to T, chromosome 4 at 18,886,061 bp
  • A to G, chromosome 4 at 128,617,077 bp
  • A to T, chromosome 4 at 143,654,527 bp
  • G to A, chromosome 4 at 148,041,625 bp
  • G to A, chromosome 4 at 154,269,703 bp
  • A to C, chromosome 5 at 3,813,135 bp
  • A to T, chromosome 5 at 8,958,441 bp
  • G to C, chromosome 5 at 25,942,169 bp
  • C to T, chromosome 6 at 29,455,519 bp
  • T to C, chromosome 6 at 56,730,643 bp
  • T to C, chromosome 6 at 73,469,534 bp
  • T to A, chromosome 7 at 11,065,568 bp
  • C to T, chromosome 7 at 19,163,570 bp
  • T to C, chromosome 7 at 30,867,966 bp
  • T to C, chromosome 7 at 127,552,644 bp
  • T to C, chromosome 7 at 141,491,903 bp
  • C to T, chromosome 8 at 24,689,468 bp
  • TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG to TCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGGCTGGCTGGTGTCCCGGGTACTGAAGGTCCCTGG, chromosome 8 at 104,309,702 bp
  • G to A, chromosome 8 at 121,554,397 bp
  • A to T, chromosome 9 at 3,634,489 bp
  • T to A, chromosome 9 at 7,446,936 bp
  • T to A, chromosome 9 at 18,643,679 bp
  • A to G, chromosome 9 at 39,647,083 bp
  • A to G, chromosome 9 at 57,921,752 bp
  • A to T, chromosome 9 at 81,632,428 bp
  • G to A, chromosome 9 at 99,505,309 bp
  • T to A, chromosome 9 at 105,293,657 bp
  • G to A, chromosome 9 at 108,112,974 bp
  • C to T, chromosome 10 at 24,182,826 bp
  • A to G, chromosome 10 at 79,819,154 bp
  • A to T, chromosome 11 at 31,872,679 bp
  • A to G, chromosome 11 at 33,964,806 bp
  • T to C, chromosome 11 at 43,776,391 bp
  • T to C, chromosome 11 at 56,029,582 bp
  • A to G, chromosome 11 at 73,187,735 bp
  • T to C, chromosome 11 at 101,326,338 bp
  • A to G, chromosome 13 at 75,939,583 bp
  • A to G, chromosome 13 at 96,780,371 bp
  • T to C, chromosome 13 at 100,229,619 bp
  • A to G, chromosome 13 at 113,617,774 bp
  • A to G, chromosome 14 at 31,662,276 bp
  • T to G, chromosome 14 at 54,695,229 bp
  • C to A, chromosome 14 at 69,719,462 bp
  • C to T, chromosome 14 at 73,238,793 bp
  • A to G, chromosome 15 at 28,419,961 bp
  • A to G, chromosome 15 at 74,543,340 bp
  • A to G, chromosome 16 at 11,201,363 bp
  • A to G, chromosome 16 at 13,403,189 bp
  • G to A, chromosome 17 at 12,960,092 bp
  • T to A, chromosome 17 at 18,439,905 bp
  • C to A, chromosome 17 at 23,345,829 bp
  • T to C, chromosome 17 at 37,232,070 bp
  • C to T, chromosome 17 at 67,804,513 bp
  • T to A, chromosome 19 at 5,484,004 bp
  • C to A, chromosome 19 at 11,013,377 bp
  • A to G, chromosome Y at 725,987 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9098 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068913-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.