Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9137Btlr/Mmmh
Stock Number:
068932-MU
Citation ID:
RRID:MMRRC_068932-MU
Other Names:
R9137 (G1)
Major Collection:

Strain Information

Itpk1
Name: inositol 1,3,4-triphosphate 5/6 kinase
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217837
HGNC: HGNC:6177
Homologene: 8588
Nes
Name: nestin
Synonyms: RC2, Marc2, ESTM46, Ifaprc2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18008
HGNC: HGNC:7756
Homologene: 136487
Abca12
Name: ATP-binding cassette, sub-family A member 12
Synonyms: 4832428G11Rik, 4833417A11Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 74591
Homologene: 45441
Atad5
Name: ATPase family, AAA domain containing 5
Synonyms: LOC237877, C130052G03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237877
Homologene: 32611
Zfat
Name: zinc finger and AT hook domain containing
Synonyms: LOC380993, Zfp406, Zfat1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380993
Homologene: 16829
Katnb1
Name: katanin p80 (WD40-containing) subunit B 1
Synonyms: KAT, 2410003J24Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 74187
HGNC: HGNC:6217
Homologene: 4302
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 26,685,634 bp
  • C to T, chromosome 1 at 40,543,017 bp
  • T to G, chromosome 1 at 71,259,366 bp
  • T to C, chromosome 1 at 85,642,576 bp
  • T to A, chromosome 1 at 89,144,925 bp
  • A to T, chromosome 1 at 136,069,006 bp
  • A to G, chromosome 1 at 181,911,595 bp
  • A to G, chromosome 1 at 195,168,332 bp
  • T to C, chromosome 2 at 26,950,560 bp
  • T to C, chromosome 2 at 52,260,490 bp
  • A to C, chromosome 2 at 146,200,765 bp
  • T to A, chromosome 3 at 67,515,468 bp
  • G to T, chromosome 3 at 87,971,344 bp
  • G to A, chromosome 3 at 107,195,181 bp
  • A to G, chromosome 3 at 114,061,523 bp
  • T to A, chromosome 4 at 33,095,571 bp
  • T to A, chromosome 5 at 52,538,019 bp
  • T to G, chromosome 5 at 108,148,990 bp
  • G to C, chromosome 5 at 113,613,982 bp
  • A to G, chromosome 5 at 120,557,925 bp
  • A to G, chromosome 5 at 121,358,175 bp
  • A to C, chromosome 5 at 145,469,603 bp
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp
  • T to A, chromosome 6 at 23,246,512 bp
  • A to T, chromosome 6 at 30,957,920 bp
  • C to T, chromosome 7 at 24,611,298 bp
  • T to G, chromosome 7 at 73,960,906 bp
  • C to T, chromosome 7 at 109,475,123 bp
  • C to T, chromosome 7 at 141,104,115 bp
  • G to A, chromosome 8 at 95,097,692 bp
  • A to T, chromosome 9 at 61,927,431 bp
  • A to G, chromosome 10 at 14,128,968 bp
  • T to C, chromosome 10 at 86,776,622 bp
  • T to C, chromosome 10 at 130,446,540 bp
  • T to G, chromosome 11 at 3,522,838 bp
  • A to T, chromosome 11 at 20,648,425 bp
  • A to G, chromosome 11 at 69,821,607 bp
  • A to T, chromosome 11 at 80,095,655 bp
  • G to A, chromosome 11 at 83,425,068 bp
  • A to G, chromosome 11 at 106,323,910 bp
  • A to G, chromosome 11 at 115,345,042 bp
  • T to A, chromosome 12 at 101,055,535 bp
  • T to C, chromosome 12 at 102,574,032 bp
  • C to T, chromosome 13 at 49,701,874 bp
  • T to C, chromosome 13 at 67,442,722 bp
  • A to G, chromosome 13 at 81,540,014 bp
  • A to G, chromosome 14 at 24,296,041 bp
  • T to A, chromosome 15 at 6,827,228 bp
  • G to T, chromosome 15 at 65,923,912 bp
  • T to A, chromosome 15 at 68,179,945 bp
  • A to G, chromosome 16 at 4,867,448 bp
  • T to A, chromosome 16 at 59,149,272 bp
  • C to T, chromosome 17 at 25,750,110 bp
  • T to A, chromosome 17 at 58,294,208 bp
  • A to G, chromosome 19 at 42,148,001 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9137 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068932-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.