Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9150Btlr/Mmmh
Stock Number:
068938-MU
Citation ID:
RRID:MMRRC_068938-MU
Other Names:
R9150 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Sgcd
Name: sarcoglycan, delta (dystrophin-associated glycoprotein)
Synonyms: delta-SG
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 24052
Homologene: 285
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: D730040M03Rik, 1110025P14Rik, Srd5a2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Slc17a7
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
Synonyms: Vglut1, 2900052E22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72961
Homologene: 113454
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Tmem87b
Name: transmembrane protein 87B
Synonyms: 2810431I02Rik, 2610301K12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72477
Homologene: 69513
Arih1
Name: ariadne RBR E3 ubiquitin protein ligase 1
Synonyms: UIP77
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23806
HGNC: HGNC:689
Homologene: 111871
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 43,075,825 bp
  • T to A, chromosome 1 at 85,113,638 bp
  • A to G, chromosome 1 at 171,276,326 bp
  • G to A, chromosome 2 at 21,826,440 bp
  • A to T, chromosome 2 at 86,008,282 bp
  • A to T, chromosome 2 at 86,346,992 bp
  • A to G, chromosome 2 at 113,843,269 bp
  • T to C, chromosome 2 at 128,845,481 bp
  • A to G, chromosome 2 at 165,298,687 bp
  • A to T, chromosome 3 at 103,081,043 bp
  • G to T, chromosome 4 at 56,740,835 bp
  • C to T, chromosome 4 at 63,121,366 bp
  • C to T, chromosome 4 at 141,517,157 bp
  • A to G, chromosome 4 at 143,571,961 bp
  • T to A, chromosome 5 at 76,149,768 bp
  • T to A, chromosome 5 at 109,219,917 bp
  • CTCCGGTGAGTGCCTCATCC to CTCC, chromosome 5 at 137,555,092 bp
  • A to G, chromosome 7 at 28,890,953 bp
  • T to A, chromosome 7 at 43,299,289 bp
  • T to G, chromosome 7 at 45,170,743 bp
  • A to G, chromosome 7 at 67,726,102 bp
  • G to C, chromosome 7 at 86,306,734 bp
  • T to C, chromosome 7 at 110,898,998 bp
  • A to C, chromosome 8 at 4,236,030 bp
  • A to T, chromosome 9 at 35,124,642 bp
  • C to A, chromosome 9 at 59,436,786 bp
  • A to T, chromosome 9 at 67,221,496 bp
  • A to G, chromosome 9 at 106,647,458 bp
  • A to T, chromosome 10 at 53,626,014 bp
  • A to T, chromosome 10 at 70,569,057 bp
  • T to C, chromosome 10 at 128,436,530 bp
  • G to A, chromosome 11 at 8,836,256 bp
  • A to T, chromosome 11 at 29,805,791 bp
  • C to T, chromosome 11 at 46,979,343 bp
  • A to C, chromosome 12 at 69,341,046 bp
  • G to A, chromosome 12 at 84,791,090 bp
  • G to A, chromosome 12 at 86,988,418 bp
  • A to T, chromosome 12 at 103,315,880 bp
  • A to T, chromosome 13 at 24,962,322 bp
  • A to G, chromosome 13 at 93,688,595 bp
  • T to A, chromosome 13 at 100,803,407 bp
  • A to T, chromosome 14 at 44,717,905 bp
  • T to A, chromosome 14 at 76,416,616 bp
  • T to A, chromosome 14 at 108,911,669 bp
  • G to A, chromosome 15 at 76,690,854 bp
  • A to G, chromosome 15 at 79,707,964 bp
  • A to T, chromosome 15 at 94,586,393 bp
  • G to T, chromosome 16 at 58,872,642 bp
  • T to C, chromosome 17 at 29,838,446 bp
  • A to T, chromosome 17 at 32,367,835 bp
  • T to A, chromosome 17 at 43,087,800 bp
  • A to G, chromosome 17 at 78,796,019 bp
  • T to C, chromosome 17 at 79,334,870 bp
  • A to G, chromosome 17 at 85,685,335 bp
  • A to G, chromosome 18 at 23,858,151 bp
  • A to C, chromosome 18 at 37,694,880 bp
  • T to A, chromosome 19 at 6,910,252 bp
  • A to T, chromosome 19 at 45,782,982 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9150 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068938-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.