Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9150Btlr/Mmmh
Stock Number:
068938-MU
Citation ID:
RRID:MMRRC_068938-MU
Other Names:
R9150 (G1)
Major Collection:

Strain Information

Tln2
Name: talin 2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 70549
VEGA: 9
Homologene: 56692
Sgcd
Name: sarcoglycan, delta (dystrophin-associated glycoprotein)
Synonyms: delta-SG
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 24052
Homologene: 285
Srd5a3
Name: steroid 5 alpha-reductase 3
Synonyms: D730040M03Rik, 1110025P14Rik, Srd5a2l
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 57357
Homologene: 41385
Slc17a7
Name: solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7
Synonyms: Vglut1, 2900052E22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72961
Homologene: 113454
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Tmem87b
Name: transmembrane protein 87B
Synonyms: 2810431I02Rik, 2610301K12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72477
Homologene: 69513
Arih1
Name: ariadne RBR E3 ubiquitin protein ligase 1
Synonyms: UIP77
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 23806
HGNC: HGNC:689
Homologene: 111871
Tsc22d1
Name: TSC22 domain family, member 1
Synonyms: TSC-22, Egr5, Tgfb1i4
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 21807
Homologene: 7573
Nemf
Name: nuclear export mediator factor
Synonyms: 4933405E14Rik, 1500011I12Rik, Sdccag1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 66244
VEGA: 12
Homologene: 3458
Phyhipl
Name: phytanoyl-CoA hydroxylase interacting protein-like
Synonyms: 4921522K17Rik, PHY2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 70911
Homologene: 13028
Tnfrsf21
Name: tumor necrosis factor receptor superfamily, member 21
Synonyms: DR6, Death receptor 6, TR7
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 94185
VEGA: 17
Homologene: 8696
Slc30a5
Name: solute carrier family 30 (zinc transporter), member 5
Synonyms: Zntl1, ZnT-5, ZTL1, 1810010K08Rik, Znt5
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69048
VEGA: 13
Homologene: 41503
Oga
Name: O-GlcNAcase
Synonyms: Hy5, 5830447M11Rik, 4833427O07Rik, 2810009A20Rik, Mgea5
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 76055
VEGA: 19
HGNC: HGNC:7056
Homologene: 8154
Dcps
Name: decapping enzyme, scavenger
Synonyms: 1700001E16Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 69305
Homologene: 32202
Twf1
Name: twinfilin actin binding protein 1
Synonyms: A6, actin monomer-binding protein, twinfilin, Twinfilin-1, Ptk9
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 19230
HGNC: HGNC:9620
Homologene: 48140
Mcm9
Name: minichromosome maintenance 9 homologous recombination repair factor
Synonyms: 9030408O17Rik, Mcmdc1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 71567
VEGA: 10
Homologene: 13546
Ttc23
Name: tetratricopeptide repeat domain 23
Synonyms: 1600012K10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67009
Homologene: 11289
Gtpbp1
Name: GTP binding protein 1
Synonyms: GP-1, GTPBP1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14904
VEGA: 15
HGNC: HGNC:4669
Homologene: 3165
Rnf41
Name: ring finger protein 41
Synonyms: 4930511A05Rik, FLRF, 4933415P08Rik, 2210404G21Rik, D10Ertd722e, Nrdp1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 67588
VEGA: 10
Homologene: 4226
Heatr5b
Name: HEAT repeat containing 5B
Synonyms: D330050P16Rik, 2010013B10Rik, A230048G03Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320473
VEGA: 17
Homologene: 25536
Pkd1l1
Name: polycystic kidney disease 1 like 1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 171395
Homologene: 51376
Slitrk1
Name: SLIT and NTRK-like family, member 1
Synonyms: 3200001I04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 76965
VEGA: 14
Homologene: 14174
Grm2
Name: glutamate receptor, metabotropic 2
Synonyms: mGluR2, 4930441L02Rik, Gprc1b
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 108068
HGNC: HGNC:4594
Homologene: 20229
Mapre2
Name: microtubule-associated protein, RP/EB family, member 2
Synonyms: D18Abb1e, RP1, EB2, C820009F03Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 212307
HGNC: HGNC:6891
Homologene: 134539
Gpld1
Name: glycosylphosphatidylinositol specific phospholipase D1
Synonyms: 6330541J12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14756
HGNC: HGNC:4459
Homologene: 1152
B4galt3
Name: UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Synonyms: beta4GalT-III, ESTM26, 9530061M23Rik, R74981
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 57370
HGNC: HGNC:926
Homologene: 48241
Ltbp2
Name: latent transforming growth factor beta binding protein 2
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 16997
HGNC: HGNC:6715
Homologene: 369
Elmo2
Name: engulfment and cell motility 2
Synonyms: 1190002F24Rik, CED-12
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 140579
Homologene: 44338
Ppp1r16a
Name: protein phosphatase 1, regulatory subunit 16A
Synonyms: 2900084E10Rik, Mypt3, R75527
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 73062
Homologene: 13161
Sp140l2
Name: Sp140 nuclear body protein like 2
Synonyms: OTTMUSG00000029174, C130026I21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 620078
Homologene: 131208
Gpr158
Name: G protein-coupled receptor 158
Synonyms: 5330427M13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241263
Homologene: 19381
Or8k53
Name: olfactory receptor family 8 subfamily K member 53
Synonyms: GA_x6K02T2Q125-47819205-47818258, MOR186-1, Olfr1055
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 259023
Homologene: 131140
Eml6
Name: echinoderm microtubule associated protein like 6
Synonyms: 2900083P10Rik, C230094A16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237711
Homologene: 104282
Actl6b
Name: actin-like 6B
Synonyms: Baf53b, ArpNa, Actl6
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 83766
HGNC: HGNC:160
Homologene: 81844
Or5k14
Name: olfactory receptor family 5 subfamily K member 14
Synonyms: GA_x54KRFPKG5P-55091371-55090442, MOR184-7, Olfr177, MOR184-8, GA_x54KRFPKG5P-55043245-55042289, Olfr176
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258998
Homologene: 121500
Ampd1
Name: adenosine monophosphate deaminase 1
Synonyms: Ampd-1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229665
HGNC: HGNC:468
Homologene: 20
Mdga1
Name: MAM domain containing glycosylphosphatidylinositol anchor 1
Synonyms: 1200011I03Rik, Mamdc3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 74762
Homologene: 17780
Wiz
Name: widely-interspaced zinc finger motifs
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22404
Homologene: 7997
Or5m3
Name: olfactory receptor family 5 subfamily M member 3
Synonyms: GA_x6K02T2Q125-47485813-47486745, MOR199-1, Olfr1032
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258572
Homologene: 17299
Lrrc8e
Name: leucine rich repeat containing 8 family, member E
Synonyms: C87354, 1810049O03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72267
Homologene: 11817
Tgfbrap1
Name: transforming growth factor, beta receptor associated protein 1
Synonyms: 3110018K12Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 73122
Homologene: 3141
Zfp618
Name: zinc finger protein 618
Synonyms: D430033D05Rik, 2810040O04Rik, 2810031P15Rik, Nedd10
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72701
Homologene: 18975
Vmn2r14
Name: vomeronasal 2, receptor 14
Synonyms: EG231591
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231591
Homologene: 129606
Irag1
Name: inositol 1,4,5-triphosphate receptor associated 1
Synonyms: Ris1, Mrvi1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17540
HGNC: HGNC:7237
Homologene: 4425
Or13g1
Name: olfactory receptor family 13 subfamily G member 1
Synonyms: GA_x6K02T2NHDJ-9801340-9802266, MOR251-4P, Olfr309
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 258196
Homologene: 47595
Zfp715
Name: zinc finger protein 715
Synonyms: 2610041B18Rik, mszf15
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 69930
Homologene: 74591
Arhgap11a
Name: Rho GTPase activating protein 11A
Synonyms: GAP (1-12), 6530401L14Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228482
Homologene: 8862
Zdhhc22
Name: zinc finger, DHHC-type containing 22
Synonyms: LOC238331
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 238331
VEGA: 12
Homologene: 45486
Dmgdh
Name: dimethylglycine dehydrogenase precursor
Synonyms: 1200014D15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74129
Homologene: 8372
Trmt112
Name: tRNA methyltransferase 11-2
Synonyms: Trm112p, 0610038D11Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 67674
Homologene: 41132
Cdc42ep3
Name: CDC42 effector protein 3
Synonyms: UB1, Cep3, Borg2, 3200001F04Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 260409
VEGA: 17
Homologene: 4708
Six2
Name: sine oculis-related homeobox 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 20472
Homologene: 56518
Gm8267
Name: predicted gene 8267
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 666744
Homologene: 115686
Fam181a
Name: family with sequence similarity 181, member A
Synonyms: EG544888
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 100504156
Homologene: 34701
Pcdhga5
Name: protocadherin gamma subfamily A, 5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93713
HGNC: HGNC:8703
Homologene: 69263
Gm26657
Name: predicted gene, 26657
Type: Gene
Species: Mouse
Chromosome: 4
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to T, chromosome 1 at 43,075,825 bp
  • T to A, chromosome 1 at 85,113,638 bp
  • A to G, chromosome 1 at 171,276,326 bp
  • G to A, chromosome 2 at 21,826,440 bp
  • A to T, chromosome 2 at 86,008,282 bp
  • A to T, chromosome 2 at 86,346,992 bp
  • A to G, chromosome 2 at 113,843,269 bp
  • T to C, chromosome 2 at 128,845,481 bp
  • A to G, chromosome 2 at 165,298,687 bp
  • A to T, chromosome 3 at 103,081,043 bp
  • G to T, chromosome 4 at 56,740,835 bp
  • C to T, chromosome 4 at 63,121,366 bp
  • C to T, chromosome 4 at 141,517,157 bp
  • A to G, chromosome 4 at 143,571,961 bp
  • T to A, chromosome 5 at 76,149,768 bp
  • T to A, chromosome 5 at 109,219,917 bp
  • CTCCGGTGAGTGCCTCATCC to CTCC, chromosome 5 at 137,555,092 bp
  • A to G, chromosome 7 at 28,890,953 bp
  • T to A, chromosome 7 at 43,299,289 bp
  • T to G, chromosome 7 at 45,170,743 bp
  • A to G, chromosome 7 at 67,726,102 bp
  • G to C, chromosome 7 at 86,306,734 bp
  • T to C, chromosome 7 at 110,898,998 bp
  • A to C, chromosome 8 at 4,236,030 bp
  • A to T, chromosome 9 at 35,124,642 bp
  • C to A, chromosome 9 at 59,436,786 bp
  • A to T, chromosome 9 at 67,221,496 bp
  • A to G, chromosome 9 at 106,647,458 bp
  • A to T, chromosome 10 at 53,626,014 bp
  • A to T, chromosome 10 at 70,569,057 bp
  • T to C, chromosome 10 at 128,436,530 bp
  • G to A, chromosome 11 at 8,836,256 bp
  • A to T, chromosome 11 at 29,805,791 bp
  • C to T, chromosome 11 at 46,979,343 bp
  • A to C, chromosome 12 at 69,341,046 bp
  • G to A, chromosome 12 at 84,791,090 bp
  • G to A, chromosome 12 at 86,988,418 bp
  • A to T, chromosome 12 at 103,315,880 bp
  • A to T, chromosome 13 at 24,962,322 bp
  • A to G, chromosome 13 at 93,688,595 bp
  • T to A, chromosome 13 at 100,803,407 bp
  • A to T, chromosome 14 at 44,717,905 bp
  • T to A, chromosome 14 at 76,416,616 bp
  • T to A, chromosome 14 at 108,911,669 bp
  • G to A, chromosome 15 at 76,690,854 bp
  • A to G, chromosome 15 at 79,707,964 bp
  • A to T, chromosome 15 at 94,586,393 bp
  • G to T, chromosome 16 at 58,872,642 bp
  • T to C, chromosome 17 at 29,838,446 bp
  • A to T, chromosome 17 at 32,367,835 bp
  • T to A, chromosome 17 at 43,087,800 bp
  • A to G, chromosome 17 at 78,796,019 bp
  • T to C, chromosome 17 at 79,334,870 bp
  • A to G, chromosome 17 at 85,685,335 bp
  • A to G, chromosome 18 at 23,858,151 bp
  • A to C, chromosome 18 at 37,694,880 bp
  • T to A, chromosome 19 at 6,910,252 bp
  • A to T, chromosome 19 at 45,782,982 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9150 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068938-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.