Strain Name:
C57BL/6J-MtgxR9260Btlr/Mmmh
Stock Number:
068962-MU
Citation ID:
RRID:MMRRC_068962-MU
Other Names:
R9260 (G1)
Major Collection:

Strain Information

Ppp5c
Name: protein phosphatase 5, catalytic subunit
Synonyms: ANP receptor, PP5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19060
HGNC: HGNC:9322
Homologene: 4550
Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, MYH-beta/slow, beta-MHC, B-MHC, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Mkrn1
Name: makorin, ring finger protein, 1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54484
HGNC: HGNC:7112
Homologene: 32175
Pmepa1
Name: prostate transmembrane protein, androgen induced 1
Synonyms: N4wbp4, 2210418I02Rik, PMEPA1, STAG1, Tmepai
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65112
Homologene: 10608
Nbea
Name: neurobeachin
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 26422
HGNC: HGNC:7648
Homologene: 69190
Smg7
Name: SMG7 nonsense mediated mRNA decay factor
Synonyms: 9430023P16Rik, Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226517
Homologene: 32235
Kdm4b
Name: lysine (K)-specific demethylase 4B
Synonyms: 4732474L06Rik, Jmjd2b
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 193796
Homologene: 27773
Snrnp200
Name: small nuclear ribonucleoprotein 200 (U5)
Synonyms: U5-200KD, HELIC2, A330064G03Rik, Ascc3l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320632
Homologene: 5859
Ints3
Name: integrator complex subunit 3
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229543
Homologene: 11309
Dnajc15
Name: DnaJ heat shock protein family (Hsp40) member C15
Synonyms: 1110003P16Rik, Dnajd1, MCJ
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66148
VEGA: 14
Homologene: 22740
Kat14
Name: lysine acetyltransferase 14
Synonyms: 2510008M08Rik, D2Ertd473e, D2Wsu131e, ATAC2, Csrp2bp
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228714
Homologene: 10745
Herc1
Name: HECT and RLD domain containing E3 ubiquitin protein ligase family member 1
Synonyms: D130015N03Rik, 2810449H11Rik, tbl
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235439
HGNC: HGNC:4867
Homologene: 31207
Unc13d
Name: unc-13 homolog D
Synonyms: Munc13-4, 2610108D09Rik, Jinx
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 70450
Homologene: 26714
Ccdc141
Name: coiled-coil domain containing 141
Synonyms: ENSMUSG00000075261, CAMDI, 2610301F02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 545428
Homologene: 52149
Pdcd6ip
Name: programmed cell death 6 interacting protein
Synonyms: Alix, AIP1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 18571
HGNC: HGNC:8766
Homologene: 22614
Casr
Name: calcium-sensing receptor
Synonyms: CaR, Gprc2a, cation sensing receptor
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12374
HGNC: HGNC:1514
Homologene: 332
Mobp
Name: myelin-associated oligodendrocytic basic protein
Synonyms: MOBP155
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 17433
HGNC: HGNC:7189
Homologene: 32040
Dnajc14
Name: DnaJ heat shock protein family (Hsp40) member C14
Synonyms: DRIP78, LIP6, HDJ3, 5730551F12Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74330
VEGA: 10
Homologene: 12553
Il31ra
Name: interleukin 31 receptor A
Synonyms: GLM-R, GPL
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218624
VEGA: 13
Homologene: 51395
Oaz1
Name: ornithine decarboxylase antizyme 1
Synonyms: Antizyme, AZ-1, antizyme 1, AZ1
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 18245
HGNC: HGNC:8095
Homologene: 7455
Uqcrfs1
Name: ubiquinol-cytochrome c reductase, Rieske iron-sulfur polypeptide 1
Synonyms: 4430402G14Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66694
Homologene: 4378
Zfp998
Name: zinc finger protein 998
Synonyms: Gt(pU21)35Imeg, Gt(Ayu21)35Imeg, 2410141K09Rik, Snerv1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 76803
Homologene: 136362
Lct
Name: lactase
Synonyms: LOC226413, Lphl, LPH
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226413
HGNC: HGNC:6530
Homologene: 124204
Wdr19
Name: WD repeat domain 19
Synonyms: C330027H04Rik, D330023L08Rik, Ift144, DYF2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 213081
Homologene: 11842
Optn
Name: optineurin
Synonyms: 4930441O07Rik, TFIIIA-INTP
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71648
Homologene: 11085
Hjv
Name: hemojuvelin BMP co-receptor
Synonyms: 2310035L15Rik, 5230400G09Rik, DL-M, Rgmc, HJV, hemojuvelin, Hfe2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 69585
HGNC: HGNC:4887
Homologene: 17060
F10
Name: coagulation factor X
Synonyms: fX, Cf10, AI194738
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 14058
HGNC: HGNC:3528
Homologene: 30976
Bmper
Name: BMP-binding endothelial regulator
Synonyms: Cv2, 3110056H04Rik, CV-2, Crim3, crossveinless-2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 73230
VEGA: 9
Homologene: 12494
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Nyap2
Name: neuronal tyrosine-phophorylated phosphoinositide 3-kinase adaptor 2
Synonyms: Jr6, 9430031J16Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 241134
Homologene: 18239
Dpyd
Name: dihydropyrimidine dehydrogenase
Synonyms: DPD, E330028L06Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 99586
HGNC: HGNC:3012
Homologene: 85
Pde9a
Name: phosphodiesterase 9A
Synonyms: PDE9A1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18585
HGNC: HGNC:8795
Homologene: 113565
Hikeshi
Name: heat shock protein nuclear import factor
Synonyms: l(7)6Rn, 1110002N09Rik, 0610007P06Rik, Hikeshi, l7Rn6
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 67669
Homologene: 6908
Cntnap4
Name: contactin associated protein-like 4
Synonyms: Caspr4, E130114F09Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 170571
Homologene: 24912
Iqcg
Name: IQ motif containing G
Synonyms: G1-374-12, stubby12d, repro1, 2400003L07Rik, esgd12d
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 69707
Homologene: 32776
Zkscan3
Name: zinc finger with KRAB and SCAN domains 3
Synonyms: 2810435N07Rik, Skz1, Zfp307, Zfp306
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 72739
Homologene: 130732
Muc5b
Name: mucin 5, subtype B, tracheobronchial
Synonyms: MUC9, MUC5, 2300002I04Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74180
HGNC: HGNC:7516
Homologene: 136756
Atp1a4
Name: ATPase, Na+/K+ transporting, alpha 4 polypeptide
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 27222
Homologene: 113769
Or5ac19
Name: olfactory receptor family 5 subfamily AC member 19
Synonyms: GA_x54KRFPKG5P-55483936-55483010, MOR182-2, Olfr201
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258996
Homologene: 37011
Chadl
Name: chondroadherin-like
Synonyms: D930017K21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 214685
Homologene: 130044
Pdk2
Name: pyruvate dehydrogenase kinase, isoenzyme 2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18604
HGNC: HGNC:8810
Homologene: 68265
Gm7168
Name: predicted gene 7168
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 635895
Homologene: 133217
Cd101
Name: CD101 antigen
Synonyms: LOC381460, Igsf2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 630146
HGNC: HGNC:5949
Homologene: 3142
Kcnh2
Name: potassium voltage-gated channel, subfamily H (eag-related), member 2
Synonyms: merg1a, ether a go-go related, M-erg, LQT, Lqt2, ERG1, merg1b
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16511
HGNC: HGNC:6251
Homologene: 201
Nsun4
Name: NOL1/NOP2/Sun domain family, member 4
Synonyms: 2310010O12Rik, 2810405F18Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72181
Homologene: 12455
Thap12
Name: THAP domain containing 12
Synonyms: 2900052B10Rik, Dap4, Prkrir
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72981
HGNC: HGNC:9440
Homologene: 37952
Nup210
Name: nucleoporin 210
Synonyms: gp210, gp190, Pom210
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 54563
Homologene: 41286
Tcaf1
Name: TRPM8 channel-associated factor 1
Synonyms: A230020K05Rik, 2810407D09Rik, 3321401G04Rik, Fam115a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 77574
Homologene: 8815
Cpb1
Name: carboxypeptidase B1
Synonyms: 2210008M23Rik, 0910001A18Rik, 1810063F02Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 76703
HGNC: HGNC:2299
Homologene: 68127
Gli3
Name: GLI-Kruppel family member GLI3
Synonyms: Bph, brachyphalangy
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14634
HGNC: HGNC:4319
Homologene: 139
Usp13
Name: ubiquitin specific peptidase 13 (isopeptidase T-3)
Synonyms: IsoT-3, ISOT3, 2700071E21Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72607
Homologene: 68372
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Osmr
Name: oncostatin M receptor
Synonyms: OSMRB
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 18414
HGNC: HGNC:8507
Homologene: 2972
Pold4
Name: polymerase (DNA-directed), delta 4
Synonyms: DNA polymerase delta smallest subunit p12, p12, 2410012M21Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 69745
VEGA: 19
Homologene: 10909
Or6c76b
Name: olfactory receptor family 6 subfamily C member 76B
Synonyms: GA_x6K02T2PULF-11535078-11536010, MOR108-3, Olfr813
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258252
Homologene: 138308
Cacnb3
Name: calcium channel, voltage-dependent, beta 3 subunit
Synonyms: Cchb3, Beta3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12297
VEGA: 15
HGNC: HGNC:1403
Homologene: 20187
Fpr1
Name: formyl peptide receptor 1
Synonyms: FPR, fMLF-R
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14293
HGNC: HGNC:3826
Homologene: 20466
Cimap2
Name: ciliary microtubule associated protein 2
Synonyms: BC055111, Lexm
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 242602
Homologene: 17630
Grip1
Name: glutamate receptor interacting protein 1
Synonyms: 4931400F03Rik, eb
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 74053
Homologene: 12938
Ehbp1l1
Name: EH domain binding protein 1-like 1
Synonyms: G430002G23Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 114601
VEGA: 19
Homologene: 136059
Pgm1
Name: phosphoglucomutase 1
Synonyms: Pgm-2, 2610020G18Rik, Pgm1a, Pgm2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 72157
HGNC: HGNC:8905
Homologene: 1979
Zmym5
Name: zinc finger, MYM-type 5
Synonyms: 9830124H08Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219105
Homologene: 16997
Pccb
Name: propionyl Coenzyme A carboxylase, beta polypeptide
Synonyms: 1300012P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66904
HGNC: HGNC:8654
Homologene: 447
Or11i1
Name: olfactory receptor family 11 subfamily I member 1
Synonyms: GA_x6K02T2N6GK-529983-529033, MOR122-2, Olfr266
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 258482
Homologene: 51728
Fam47e
Name: family with sequence similarity 47, member E
Synonyms: LOC384198, Gm1381
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384198
Homologene: 129958
Clec4a4
Name: C-type lectin domain family 4, member a4
Synonyms: Dcir2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 474145
Homologene: 133910
Stbd1
Name: starch binding domain 1
Synonyms: D530019K15Rik, D5Ertd593e
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 52331
Homologene: 2929
Micall2
Name: MICAL-like 2
Synonyms: Jrab, MICAL-L2, A930021H16Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231830
Homologene: 85155
Kbtbd13
Name: kelch repeat and BTB (POZ) domain containing 13
Synonyms: 5430433E21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74492
Homologene: 19285
Prrt1
Name: proline-rich transmembrane protein 1
Synonyms: G5b, NG5, SynDIG4
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 260297
Homologene: 134500
Or7a40
Name: olfactory receptor family 7 subfamily A member 40
Synonyms: MTPCR15, MOR140-1, GA_x54KRFPKG5P-13123979-13123050, M12, Olfr19
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 18316
Homologene: 137402
Psmb11
Name: proteasome (prosome, macropain) subunit, beta type, 11
Synonyms: beta5t, 5830406J20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 73902
VEGA: 14
Homologene: 13729
Or4f17-ps1
Name: olfactory receptor family 4 subfamily F member 17, pseudogene 1
Synonyms: GA_x6K02T2Q125-72578807-72579745, MOR245-24P, OTTMUSG00000015076, Olfr1293-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 623583
Igkv6-23
Name: immunoglobulin kappa variable 6-23
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 637227
HGNC: HGNC:5834
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 81,087,118 bp
  • C to T, chromosome 1 at 128,299,967 bp
  • T to C, chromosome 1 at 135,979,956 bp
  • A to G, chromosome 1 at 152,861,798 bp
  • A to G, chromosome 1 at 172,246,792 bp
  • C to T, chromosome 2 at 5,040,265 bp
  • T to C, chromosome 2 at 76,815,575 bp
  • C to A, chromosome 2 at 77,014,451 bp
  • T to A, chromosome 2 at 111,527,926 bp
  • T to A, chromosome 2 at 127,236,508 bp
  • T to A, chromosome 2 at 144,393,521 bp
  • CCGGCGGCGGCGGCGGCGG to CCGGCGGCGGCGGCGG, chromosome 2 at 173,276,150 bp
  • T to A, chromosome 3 at 20,262,474 bp
  • T to A, chromosome 3 at 32,901,760 bp
  • G to C, chromosome 3 at 53,652,783 bp
  • A to C, chromosome 3 at 55,983,812 bp
  • T to C, chromosome 3 at 90,401,161 bp
  • T to A, chromosome 3 at 96,528,263 bp
  • A to T, chromosome 3 at 101,013,283 bp
  • A to G, chromosome 3 at 106,822,194 bp
  • A to T, chromosome 3 at 119,314,798 bp
  • T to A, chromosome 4 at 99,969,989 bp
  • T to C, chromosome 4 at 106,615,437 bp
  • T to C, chromosome 4 at 116,044,810 bp
  • T to A, chromosome 5 at 14,714,273 bp
  • A to T, chromosome 5 at 24,323,071 bp
  • T to A, chromosome 5 at 65,206,446 bp
  • C to T, chromosome 5 at 92,587,525 bp
  • A to T, chromosome 5 at 92,605,597 bp
  • T to A, chromosome 5 at 139,709,698 bp
  • T to C, chromosome 6 at 39,405,596 bp
  • C to T, chromosome 6 at 42,686,620 bp
  • T to A, chromosome 6 at 70,260,473 bp
  • A to G, chromosome 6 at 91,062,803 bp
  • C to T, chromosome 6 at 123,023,936 bp
  • C to T, chromosome 7 at 17,006,961 bp
  • T to C, chromosome 7 at 89,930,568 bp
  • C to T, chromosome 7 at 98,707,073 bp
  • T to A, chromosome 7 at 141,851,518 bp
  • G to A, chromosome 8 at 13,055,638 bp
  • A to G, chromosome 8 at 112,773,644 bp
  • T to A, chromosome 9 at 23,406,720 bp
  • T to C, chromosome 9 at 65,391,570 bp
  • T to A, chromosome 9 at 66,418,409 bp
  • G to T, chromosome 9 at 100,995,590 bp
  • A to T, chromosome 9 at 113,697,504 bp
  • A to G, chromosome 9 at 120,168,506 bp
  • T to A, chromosome 10 at 80,826,769 bp
  • G to A, chromosome 10 at 120,038,664 bp
  • T to G, chromosome 10 at 128,806,897 bp
  • G to A, chromosome 10 at 129,856,589 bp
  • C to A, chromosome 11 at 95,039,434 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • T to C, chromosome 12 at 115,335,117 bp
  • G to T, chromosome 13 at 15,725,090 bp
  • A to T, chromosome 13 at 21,394,040 bp
  • G to A, chromosome 13 at 30,541,125 bp
  • A to T, chromosome 13 at 66,431,316 bp
  • T to C, chromosome 13 at 68,580,555 bp
  • A to T, chromosome 13 at 112,531,668 bp
  • A to T, chromosome 14 at 54,625,576 bp
  • G to A, chromosome 14 at 54,987,385 bp
  • A to C, chromosome 14 at 56,804,184 bp
  • A to G, chromosome 14 at 77,844,399 bp
  • T to A, chromosome 15 at 6,852,552 bp
  • A to G, chromosome 15 at 81,693,857 bp
  • A to G, chromosome 15 at 98,639,557 bp
  • A to T, chromosome 16 at 16,673,473 bp
  • G to A, chromosome 16 at 33,035,603 bp
  • T to C, chromosome 16 at 36,509,964 bp
  • T to C, chromosome 16 at 59,269,314 bp
  • A to T, chromosome 17 at 13,949,226 bp
  • A to T, chromosome 17 at 17,877,744 bp
  • T to C, chromosome 17 at 31,459,163 bp
  • A to G, chromosome 17 at 32,143,242 bp
  • A to G, chromosome 17 at 34,631,146 bp
  • A to G, chromosome 17 at 56,394,775 bp
  • T to C, chromosome 19 at 4,232,850 bp
  • A to G, chromosome 19 at 5,719,250 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9260 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068962-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.