Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9260Btlr/Mmmh
Stock Number:
068962-MU
Citation ID:
RRID:MMRRC_068962-MU
Other Names:
R9260 (G1)
Major Collection:

Strain Information

Ppp5c
Name: protein phosphatase 5, catalytic subunit
Synonyms: ANP receptor, PP5
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 19060
HGNC: HGNC:9322
Homologene: 4550
Mtrr
Name: 5-methyltetrahydrofolate-homocysteine methyltransferase reductase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 210009
VEGA: 13
HGNC: HGNC:7473
Homologene: 11419
Notch3
Name: notch 3
Synonyms: hpbk, N3
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 18131
HGNC: HGNC:7883
Homologene: 376
Myh7
Name: myosin, heavy polypeptide 7, cardiac muscle, beta
Synonyms: Myhc-b, Myhcb, beta-MHC, B-MHC, MYH-beta/slow, MyHC-I, betaMHC
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 140781
HGNC: HGNC:7577
Homologene: 68044
Frem2
Name: Fras1 related extracellular matrix protein 2
Synonyms: 8430406N05Rik, 6030440P17Rik, my, ne, b2b1562Clo
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 242022
Homologene: 18454
Pmepa1
Name: prostate transmembrane protein, androgen induced 1
Synonyms: N4wbp4, 2210418I02Rik, PMEPA1, STAG1, Tmepai
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 65112
Homologene: 10608
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 81,087,118 bp
  • C to T, chromosome 1 at 128,299,967 bp
  • T to C, chromosome 1 at 135,979,956 bp
  • A to G, chromosome 1 at 152,861,798 bp
  • A to G, chromosome 1 at 172,246,792 bp
  • C to T, chromosome 2 at 5,040,265 bp
  • T to C, chromosome 2 at 76,815,575 bp
  • C to A, chromosome 2 at 77,014,451 bp
  • T to A, chromosome 2 at 111,527,926 bp
  • T to A, chromosome 2 at 127,236,508 bp
  • T to A, chromosome 2 at 144,393,521 bp
  • CCGGCGGCGGCGGCGGCGG to CCGGCGGCGGCGGCGG, chromosome 2 at 173,276,150 bp
  • T to A, chromosome 3 at 20,262,474 bp
  • T to A, chromosome 3 at 32,901,760 bp
  • G to C, chromosome 3 at 53,652,783 bp
  • A to C, chromosome 3 at 55,983,812 bp
  • T to C, chromosome 3 at 90,401,161 bp
  • T to A, chromosome 3 at 96,528,263 bp
  • A to T, chromosome 3 at 101,013,283 bp
  • A to G, chromosome 3 at 106,822,194 bp
  • A to T, chromosome 3 at 119,314,798 bp
  • T to A, chromosome 4 at 99,969,989 bp
  • T to C, chromosome 4 at 106,615,437 bp
  • T to C, chromosome 4 at 116,044,810 bp
  • T to A, chromosome 5 at 14,714,273 bp
  • A to T, chromosome 5 at 24,323,071 bp
  • T to A, chromosome 5 at 65,206,446 bp
  • C to T, chromosome 5 at 92,587,525 bp
  • A to T, chromosome 5 at 92,605,597 bp
  • T to A, chromosome 5 at 139,709,698 bp
  • T to C, chromosome 6 at 39,405,596 bp
  • C to T, chromosome 6 at 42,686,620 bp
  • T to A, chromosome 6 at 70,260,473 bp
  • A to G, chromosome 6 at 91,062,803 bp
  • C to T, chromosome 6 at 123,023,936 bp
  • C to T, chromosome 7 at 17,006,961 bp
  • T to C, chromosome 7 at 89,930,568 bp
  • C to T, chromosome 7 at 98,707,073 bp
  • T to A, chromosome 7 at 141,851,518 bp
  • G to A, chromosome 8 at 13,055,638 bp
  • A to G, chromosome 8 at 112,773,644 bp
  • T to A, chromosome 9 at 23,406,720 bp
  • T to C, chromosome 9 at 65,391,570 bp
  • T to A, chromosome 9 at 66,418,409 bp
  • G to T, chromosome 9 at 100,995,590 bp
  • A to T, chromosome 9 at 113,697,504 bp
  • A to G, chromosome 9 at 120,168,506 bp
  • T to A, chromosome 10 at 80,826,769 bp
  • G to A, chromosome 10 at 120,038,664 bp
  • T to G, chromosome 10 at 128,806,897 bp
  • G to A, chromosome 10 at 129,856,589 bp
  • C to A, chromosome 11 at 95,039,434 bp
  • AATGCCTCCCATGCC to AATGCCTCCCATGCCTCCCATGCC, chromosome 11 at 116,068,172 bp
  • T to C, chromosome 12 at 115,335,117 bp
  • G to T, chromosome 13 at 15,725,090 bp
  • A to T, chromosome 13 at 21,394,040 bp
  • G to A, chromosome 13 at 30,541,125 bp
  • A to T, chromosome 13 at 66,431,316 bp
  • T to C, chromosome 13 at 68,580,555 bp
  • A to T, chromosome 13 at 112,531,668 bp
  • A to T, chromosome 14 at 54,625,576 bp
  • G to A, chromosome 14 at 54,987,385 bp
  • A to C, chromosome 14 at 56,804,184 bp
  • A to G, chromosome 14 at 77,844,399 bp
  • T to A, chromosome 15 at 6,852,552 bp
  • A to G, chromosome 15 at 81,693,857 bp
  • A to G, chromosome 15 at 98,639,557 bp
  • A to T, chromosome 16 at 16,673,473 bp
  • G to A, chromosome 16 at 33,035,603 bp
  • T to C, chromosome 16 at 36,509,964 bp
  • T to C, chromosome 16 at 59,269,314 bp
  • A to T, chromosome 17 at 13,949,226 bp
  • A to T, chromosome 17 at 17,877,744 bp
  • T to C, chromosome 17 at 31,459,163 bp
  • A to G, chromosome 17 at 32,143,242 bp
  • A to G, chromosome 17 at 34,631,146 bp
  • A to G, chromosome 17 at 56,394,775 bp
  • T to C, chromosome 19 at 4,232,850 bp
  • A to G, chromosome 19 at 5,719,250 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9260 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068962-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.