Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9298Btlr/Mmmh
Stock Number:
068963-MU
Citation ID:
RRID:MMRRC_068963-MU
Other Names:
R9298 (G1)
Major Collection:

Strain Information

Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Runx1
Name: runt related transcription factor 1
Synonyms: AML1, Pebp2a2, runt domain, alpha subunit 2, Cbfa2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12394
Homologene: 1331
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Rb-Bp2, Plu1, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Apbb2
Name: amyloid beta precursor protein binding family B member 2
Synonyms: TR2L, Rirl1, 2310007D03Rik, Zfra, FE65L1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11787
HGNC: HGNC:582
Homologene: 32079
Btaf1
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107182
Homologene: 31978
Eif4b
Name: eukaryotic translation initiation factor 4B
Synonyms: 2310046H11Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 75705
VEGA: 15
HGNC: HGNC:3285
Homologene: 83162
Syt14
Name: synaptotagmin XIV
Synonyms: B230320I09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329324
Homologene: 17719
Tle3
Name: transducin-like enhancer of split 3
Synonyms: Grg3b, Grg3a, ESG, 2610103N05Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 21887
Homologene: 21059
Flrt3
Name: fibronectin leucine rich transmembrane protein 3
Synonyms: 5530600M07Rik, C430047I10Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 71436
HGNC: HGNC:3762
Homologene: 8322
Synrg
Name: synergin, gamma
Synonyms: L71-5, Ap1gbp1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217030
HGNC: HGNC:557
Homologene: 105680
Plekhm2
Name: pleckstrin homology domain containing, family M (with RUN domain) member 2
Synonyms: 2310034J19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 69582
Homologene: 19575
Dnhd1
Name: dynein heavy chain domain 1
Synonyms: 8030491N06Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 77505
Homologene: 131117
Zglp1
Name: zinc finger, GATA-like protein 1
Synonyms: Glp1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 100009600
VEGA: 9
Homologene: 104472
Col1a2
Name: collagen, type I, alpha 2
Synonyms: Col1a-2, Cola2, Cola-2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12843
HGNC: HGNC:2198
Homologene: 69
Dusp19
Name: dual specificity phosphatase 19
Synonyms: C79103, 5930436K22Rik, SKRP1, TS-DSP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 68082
Homologene: 41565
Iigp1
Name: interferon inducible GTPase 1
Synonyms: 2900074L10Rik, Irga6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 60440
VEGA: 18
Gm10226
Name: predicted gene 10226
Type: Gene
Species: Mouse
Chromosome: 17
Csmd3
Name: CUB and Sushi multiple domains 3
Synonyms: 4930500N14Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 239420
Homologene: 65982
Maz
Name: MYC-associated zinc finger protein (purine-binding transcription factor)
Synonyms: Pur-1, SAF-1, PUR1, SAF-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 17188
HGNC: HGNC:6914
Homologene: 106451
Slc7a6
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 6
Synonyms: LAT-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 330836
Homologene: 62496
4930407I10Rik
Name: RIKEN cDNA 4930407I10 gene
Synonyms: LOC328573
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328573
VEGA: 15
Homologene: 130065
Unc13a
Name: unc-13 homolog A
Synonyms: Munc13-1, 2410078G03Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 382018
Homologene: 11279
S100pbp
Name: S100P binding protein
Synonyms: 4930429A08Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74648
Homologene: 81892
Sobp
Name: sine oculis binding protein
Synonyms: 2900009C16Rik, 5330439J01Rik, Jxc1, jc
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 109205
Homologene: 41216
Col6a4
Name: collagen, type VI, alpha 4
Synonyms: EG235580, 1110001D15Rik, Dvwa, Vwa6
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 68553
Homologene: 130754
Cmklr1
Name: chemerin chemokine-like receptor 1
Synonyms: Gpcr27, ChemR23
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 14747
HGNC: HGNC:2121
Homologene: 129967
Fau
Name: FAU ubiquitin like and ribosomal protein S30 fusion
Synonyms: monoclonal nonspecific suppressor factor beta, MNSFbeta, MNSFB, Finkel-Biskis-Reilly murine sarcoma virus (FBR-MuSV) ubiquitously expressed (fox derived)
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 14109
VEGA: 19
HGNC: HGNC:3597
Homologene: 37562
Igfn1
Name: immunoglobulin-like and fibronectin type III domain containing 1
Synonyms: 9830123M21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226438
Homologene: 130054
Sema5a
Name: sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A
Synonyms: M-Sema D, semF, Semaf, 9130201M22Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20356
VEGA: 15
Homologene: 2949
Wiz
Name: widely-interspaced zinc finger motifs
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 22404
Homologene: 7997
Kdm4d
Name: lysine (K)-specific demethylase 4D
Synonyms: Jmjd2d
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244694
Homologene: 69244
Kcnt2
Name: potassium channel, subfamily T, member 2
Synonyms: E330038N15Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 240776
Homologene: 16121
Svop
Name: SV2 related protein
Synonyms: 1110030H18Rik, msvop
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 68666
Homologene: 41283
Slc66a2
Name: solute carrier family 66 member 2
Synonyms: C78974, 5730564E11Rik, 4933425L21Rik, 2310009N05Rik, Pqlc1
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 66943
Homologene: 32623
Cyp4a29
Name: cytochrome P450, family 4, subfamily a, polypeptide 29
Synonyms: Cyp4a29-ps
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230639
Vmn1r121
Name: vomeronasal 1 receptor 121
Synonyms: Gm8533
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667240
Homologene: 104166
Pigc
Name: phosphatidylinositol glycan anchor biosynthesis, class C
Synonyms: 3110030E07Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 67292
HGNC: HGNC:8960
Homologene: 7109
Zfp672
Name: zinc finger protein 672
Synonyms: 4930488P06Rik, 4930511N19Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 319475
Homologene: 23493
Zfp709
Name: zinc finger protein 709
Synonyms: GIOT-4
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 236193
Homologene: 136795
Tcp11l1
Name: t-complex 11 like 1
Synonyms: C130096D04Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320554
Homologene: 41260
Or2h1b
Name: olfactory receptor family 2 subfamily H member 1B
Synonyms: MOR256-39P, GA_x6K02T2PSCP-1592036-1591098, Olfr93
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 258051
HGNC: HGNC:8252
Homologene: 79436
1700030K09Rik
Name: RIKEN cDNA 1700030K09 gene
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72254
Homologene: 12975
Or10a5
Name: olfactory receptor family 10 subfamily A member 5
Synonyms: GA_x6K02T2PBJ9-9415724-9416677, MOR263-1, P3, Olfr713
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259036
Homologene: 17470
Gm4353
Name: predicted gene 4353
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043313
VEGA: 7
Catsperb
Name: cation channel sperm associated auxiliary subunit beta
Synonyms: 4932415G16Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 271036
VEGA: 12
Homologene: 81904
Arhgef37
Name: Rho guanine nucleotide exchange factor 37
Synonyms: 4933429F08Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 328967
VEGA: 18
Homologene: 28467
Slc38a8
Name: solute carrier family 38, member 8
Synonyms: LOC234788
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234788
Homologene: 19028
Slc4a1ap
Name: solute carrier family 4 (anion exchanger), member 1, adaptor protein
Synonyms: kanadaptin
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 20534
Homologene: 7543
Kctd14
Name: potassium channel tetramerisation domain containing 14
Synonyms: D7Ertd760e, AI449310
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233529
Homologene: 11396
Or5b95
Name: olfactory receptor family 5 subfamily B member 95
Synonyms: GA_x6K02T2RE5P-3006492-3007430, MOR202-8, Olfr1443
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258693
HGNC: HGNC:8324
Homologene: 115496
Fpgt
Name: fucose-1-phosphate guanylyltransferase
Synonyms: 1700016E03Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 75540
HGNC: HGNC:3825
Homologene: 2847
Tex51
Name: testis expressed 51
Synonyms: Gm35060
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 102638514
Homologene: 132337
Cdhr17
Name: cadherin related family member 17
Synonyms: Gm28710
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 102640594
Homologene: 141132
Exosc6
Name: exosome component 6
Synonyms: Mtr3, 2610510N21Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 72544
Homologene: 12469
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 134,600,755 bp
  • A to G, chromosome 1 at 135,998,589 bp
  • T to A, chromosome 1 at 140,425,297 bp
  • C to T, chromosome 1 at 161,970,463 bp
  • C to A, chromosome 1 at 192,930,636 bp
  • T to C, chromosome 2 at 80,617,385 bp
  • C to T, chromosome 2 at 104,698,552 bp
  • T to C, chromosome 2 at 140,659,959 bp
  • A to T, chromosome 2 at 175,170,076 bp
  • A to T, chromosome 3 at 155,087,058 bp
  • T to A, chromosome 4 at 115,251,198 bp
  • A to G, chromosome 4 at 129,151,054 bp
  • C to A, chromosome 4 at 141,629,518 bp
  • T to A, chromosome 5 at 16,791,857 bp
  • T to C, chromosome 5 at 31,536,194 bp
  • T to C, chromosome 5 at 66,451,675 bp
  • G to C, chromosome 5 at 113,613,982 bp
  • G to A, chromosome 5 at 114,030,170 bp
  • T to A, chromosome 6 at 4,515,260 bp
  • A to C, chromosome 7 at 21,098,419 bp
  • G to A, chromosome 7 at 87,376,240 bp
  • A to G, chromosome 7 at 97,458,036 bp
  • A to G, chromosome 7 at 105,683,966 bp
  • A to T, chromosome 7 at 107,036,433 bp
  • T to A, chromosome 7 at 116,083,608 bp
  • CGCGGCCTCGGCGGCTGGTGCGG to CGCGG, chromosome 7 at 127,025,903 bp
  • C to T, chromosome 8 at 71,655,691 bp
  • A to T, chromosome 8 at 71,890,804 bp
  • C to A, chromosome 8 at 72,445,079 bp
  • T to C, chromosome 8 at 106,195,902 bp
  • G to A, chromosome 8 at 111,056,881 bp
  • A to G, chromosome 8 at 119,486,112 bp
  • G to A, chromosome 9 at 14,464,040 bp
  • A to T, chromosome 9 at 21,066,186 bp
  • T to A, chromosome 9 at 61,412,280 bp
  • A to G, chromosome 9 at 106,068,335 bp
  • A to T, chromosome 10 at 43,022,906 bp
  • G to A, chromosome 10 at 77,057,370 bp
  • A to T, chromosome 11 at 58,329,764 bp
  • A to G, chromosome 11 at 84,009,452 bp
  • A to G, chromosome 12 at 101,594,341 bp
  • A to G, chromosome 15 at 32,618,894 bp
  • A to C, chromosome 15 at 47,753,791 bp
  • A to G, chromosome 15 at 82,063,414 bp
  • A to G, chromosome 15 at 102,082,014 bp
  • A to G, chromosome 16 at 13,384,218 bp
  • T to A, chromosome 16 at 92,644,259 bp
  • A to G, chromosome 16 at 93,800,199 bp
  • A to G, chromosome 17 at 21,691,861 bp
  • A to G, chromosome 17 at 32,361,740 bp
  • A to T, chromosome 17 at 37,151,681 bp
  • T to C, chromosome 18 at 32,460,976 bp
  • T to G, chromosome 18 at 60,389,991 bp
  • G to T, chromosome 18 at 61,518,001 bp
  • T to C, chromosome 18 at 80,257,085 bp
  • G to A, chromosome 19 at 6,058,267 bp
  • T to A, chromosome 19 at 12,680,826 bp
  • A to G, chromosome 19 at 36,986,714 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9298 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068963-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.