Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9298Btlr/Mmmh
Stock Number:
068963-MU
Citation ID:
RRID:MMRRC_068963-MU
Other Names:
R9298 (G1)
Major Collection:

Strain Information

Mrtfb
Name: myocardin related transcription factor B
Synonyms: MRTF-B, Gt4-1, Mrtfb, Mkl2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 239719
Homologene: 40917
Runx1
Name: runt related transcription factor 1
Synonyms: AML1, Pebp2a2, runt domain, alpha subunit 2, Cbfa2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 12394
Homologene: 1331
Dop1b
Name: DOP1 leucine zipper like protein B
Synonyms: 0610038M01Rik, 2610510B01Rik, Dopey2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 70028
VEGA: 16
HGNC: HGNC:1291
Homologene: 21068
Kdm5b
Name: lysine demethylase 5B
Synonyms: PLU-1, 2010009J12Rik, Plu1, Rb-Bp2, 2210016I17Rik, D1Ertd202e, Jarid1b
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 75605
Homologene: 48448
Col18a1
Name: collagen, type XVIII, alpha 1
Synonyms: endostatin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 12822
HGNC: HGNC:2195
Homologene: 7673
Apbb2
Name: amyloid beta precursor protein binding family B member 2
Synonyms: TR2L, Rirl1, 2310007D03Rik, Zfra, FE65L1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11787
HGNC: HGNC:582
Homologene: 32079
Btaf1
Name: B-TFIID TATA-box binding protein associated factor 1
Synonyms: E430027O22Rik
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107182
Homologene: 31978
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to C, chromosome 1 at 134,600,755 bp
  • A to G, chromosome 1 at 135,998,589 bp
  • T to A, chromosome 1 at 140,425,297 bp
  • C to T, chromosome 1 at 161,970,463 bp
  • C to A, chromosome 1 at 192,930,636 bp
  • T to C, chromosome 2 at 80,617,385 bp
  • C to T, chromosome 2 at 104,698,552 bp
  • T to C, chromosome 2 at 140,659,959 bp
  • A to T, chromosome 2 at 175,170,076 bp
  • A to T, chromosome 3 at 155,087,058 bp
  • T to A, chromosome 4 at 115,251,198 bp
  • A to G, chromosome 4 at 129,151,054 bp
  • C to A, chromosome 4 at 141,629,518 bp
  • T to A, chromosome 5 at 16,791,857 bp
  • T to C, chromosome 5 at 31,536,194 bp
  • T to C, chromosome 5 at 66,451,675 bp
  • G to C, chromosome 5 at 113,613,982 bp
  • G to A, chromosome 5 at 114,030,170 bp
  • T to A, chromosome 6 at 4,515,260 bp
  • A to C, chromosome 7 at 21,098,419 bp
  • G to A, chromosome 7 at 87,376,240 bp
  • A to G, chromosome 7 at 97,458,036 bp
  • A to G, chromosome 7 at 105,683,966 bp
  • A to T, chromosome 7 at 107,036,433 bp
  • T to A, chromosome 7 at 116,083,608 bp
  • CGCGGCCTCGGCGGCTGGTGCGG to CGCGG, chromosome 7 at 127,025,903 bp
  • C to T, chromosome 8 at 71,655,691 bp
  • A to T, chromosome 8 at 71,890,804 bp
  • C to A, chromosome 8 at 72,445,079 bp
  • T to C, chromosome 8 at 106,195,902 bp
  • G to A, chromosome 8 at 111,056,881 bp
  • A to G, chromosome 8 at 119,486,112 bp
  • G to A, chromosome 9 at 14,464,040 bp
  • A to T, chromosome 9 at 21,066,186 bp
  • T to A, chromosome 9 at 61,412,280 bp
  • A to G, chromosome 9 at 106,068,335 bp
  • A to T, chromosome 10 at 43,022,906 bp
  • G to A, chromosome 10 at 77,057,370 bp
  • A to T, chromosome 11 at 58,329,764 bp
  • A to G, chromosome 11 at 84,009,452 bp
  • A to G, chromosome 12 at 101,594,341 bp
  • A to G, chromosome 15 at 32,618,894 bp
  • A to C, chromosome 15 at 47,753,791 bp
  • A to G, chromosome 15 at 82,063,414 bp
  • A to G, chromosome 15 at 102,082,014 bp
  • A to G, chromosome 16 at 13,384,218 bp
  • T to A, chromosome 16 at 92,644,259 bp
  • A to G, chromosome 16 at 93,800,199 bp
  • A to G, chromosome 17 at 21,691,861 bp
  • A to G, chromosome 17 at 32,361,740 bp
  • A to T, chromosome 17 at 37,151,681 bp
  • T to C, chromosome 18 at 32,460,976 bp
  • T to G, chromosome 18 at 60,389,991 bp
  • G to T, chromosome 18 at 61,518,001 bp
  • T to C, chromosome 18 at 80,257,085 bp
  • G to A, chromosome 19 at 6,058,267 bp
  • T to A, chromosome 19 at 12,680,826 bp
  • A to G, chromosome 19 at 36,986,714 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9298 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068963-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.