Strain Name:
C57BL/6J-MtgxR9569Btlr/Mmmh
Stock Number:
068966-MU
Citation ID:
RRID:MMRRC_068966-MU
Other Names:
R9569 (G1)
Major Collection:

Strain Information

Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Hsp90ab1
Name: heat shock protein 90 alpha (cytosolic), class B member 1
Synonyms: Hsp84, Hsp90, Hsp84-1, C81438, Hspcb
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15516
Homologene: 74306
Kif2a
Name: kinesin family member 2A
Synonyms: Kns2, Kif2, M-kinesin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16563
HGNC: HGNC:6318
Homologene: 3320
Kdm3a
Name: lysine (K)-specific demethylase 3A
Synonyms: 1700105C21Rik, Tsga, C230043E16Rik, Jmjd1, Jmjd1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 104263
Homologene: 10196
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Ube2o
Name: ubiquitin-conjugating enzyme E2O
Synonyms: B230113M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217342
Homologene: 11113
Net1
Name: neuroepithelial cell transforming gene 1
Synonyms: mNET1, Net1 homolog, 9530071N24Rik, 0610025H04Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 56349
VEGA: 13
Homologene: 4283
Znfx1
Name: zinc finger, NFX1-type containing 1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 98999
Homologene: 10877
Yeats2
Name: YEATS domain containing 2
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 208146
VEGA: 16
Homologene: 9967
Eif2ak4
Name: eukaryotic translation initiation factor 2 alpha kinase 4
Synonyms: GCN2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 27103
Homologene: 40891
Unk
Name: unkempt family zinc finger
Synonyms: B230379M23Rik, Zc3h5
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217331
Homologene: 18194
Bltp1
Name: bridge-like lipid transfer protein family member 1
Synonyms: Tweek, FSA, 4932438A13Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229227
Homologene: 52105
Abi2
Name: abl interactor 2
Synonyms: 8430425M24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 329165
Homologene: 4209
Xpo7
Name: exportin 7
Synonyms: Ranbp16, 4930506C02Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 65246
VEGA: 14
Homologene: 22857
Rffl
Name: ring finger and FYVE like domain containing protein
Synonyms: 4930516L10Rik, fring, rififylin, 1700051E09Rik, Carp-2, Carp2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 67338
Homologene: 12116
Zkscan5
Name: zinc finger with KRAB and SCAN domains 5
Synonyms: hKraba1, Zfp95
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22757
Homologene: 8734
Cic
Name: capicua transcriptional repressor
Synonyms: 1200010B10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 71722
Homologene: 87637
Scube1
Name: signal peptide, CUB domain, EGF-like 1
Synonyms: A630023E24Rik, 7330410C13Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 64706
Homologene: 11224
Sox14
Name: SRY (sex determining region Y)-box 14
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20669
Homologene: 31224
D5Ertd579e
Name: DNA segment, Chr 5, ERATO Doi 579, expressed
Synonyms: 9030221A05Rik, A930018H20Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320661
Homologene: 19716
Gpx8
Name: glutathione peroxidase 8 (putative)
Synonyms: 2310016C16Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 69590
VEGA: 13
Homologene: 88454
Bub1b
Name: BUB1B, mitotic checkpoint serine/threonine kinase
Synonyms: BUBR1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12236
HGNC: HGNC:1149
Homologene: 933
Zfp142
Name: zinc finger protein 142
Synonyms: 9330177B18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77264
Homologene: 3723
Tsc22d4
Name: Tsc22 domain family, member 4
Synonyms: Thg-1pit, 0610009M14Rik, 1700023B23Rik, Tsc22d4, Spacdr
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 78829
Homologene: 11390
Zfp473
Name: zinc finger protein 473
Synonyms: D030014N22Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243963
Homologene: 18698
Zfp975
Name: zinc finger protein 975
Synonyms: Gm5595
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434179
Homologene: 134004
Tmub2
Name: transmembrane and ubiquitin-like domain containing 2
Synonyms: 2010008E23Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 72053
Homologene: 18581
Washc5
Name: WASH complex subunit 5
Synonyms: strumpellin, E430025E21Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223593
VEGA: 15
Homologene: 8898
Adgrd1
Name: adhesion G protein-coupled receptor D1
Synonyms: E230012M21Rik, Gpr133
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243277
Homologene: 34616
Apeh
Name: acylpeptide hydrolase
Synonyms: N-acylaminoacyl peptide hydrolase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235606
HGNC: HGNC:586
Homologene: 1240
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Pclo
Name: piccolo (presynaptic cytomatrix protein)
Synonyms: Acz, Pico
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26875
Homologene: 69111
Unc13b
Name: unc-13 homolog B
Synonyms: Unc13h2, Munc13-2
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 22249
Homologene: 31376
Psd
Name: pleckstrin and Sec7 domain containing
Synonyms: Efa6, 1110007H17Rik, Psdl, Efa6a
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 73728
VEGA: 19
HGNC: HGNC:9507
Homologene: 31115
Fat3
Name: FAT atypical cadherin 3
Synonyms: LOC234973, LOC382129, 9430076A06Rik, D430038H04Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 270120
VEGA: 9
Homologene: 82252
Naip5
Name: NLR family, apoptosis inhibitory protein 5
Synonyms: Naip-rs3, Birc1e, Lgn1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17951
HGNC: HGNC:7634
Homologene: 113589
Cd180
Name: CD180 antigen
Synonyms: RP105, Ly78
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 17079
HGNC: HGNC:6726
Homologene: 4077
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Scn2a
Name: sodium channel, voltage-gated, type II, alpha
Synonyms: Nav1.2, A230052E19Rik, Scn2a1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 110876
Homologene: 75001
Hc
Name: hemolytic complement
Synonyms: C5a, C5, He, Hfib2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Spata31g1
Name: SPATA31 subfamily G member 1
Synonyms: 1700022I11Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67317
Homologene: 52406
Clca3a2
Name: chloride channel accessory 3A2
Synonyms: Clca2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 80797
HGNC: HGNC:2017
Homologene: 77224
Dclk1
Name: doublecortin-like kinase 1
Synonyms: CPG16, DCLK, 1700113D08Rik, 2810480F11Rik, Dcl, Click-I, Dcamkl1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 13175
HGNC: HGNC:2700
Homologene: 130530
Or5h17
Name: olfactory receptor family 5 subfamily H member 17
Synonyms: GA_x54KRFPKG5P-55229158-55230087, MOR183-2, Olfr183
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 258478
Homologene: 27178
Pcdhb13
Name: protocadherin beta 13
Synonyms: PcdhbM, Pcdbh6
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93884
HGNC: HGNC:8691
Homologene: 10338
Duox1
Name: dual oxidase 1
Synonyms: NOXEF1, THOX1, LNOX1, 9930101G15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 99439
HGNC: HGNC:3062
Homologene: 68136
Umodl1
Name: uromodulin-like 1
Synonyms: D17Ertd488e
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 52020
VEGA: 17
Homologene: 45466
Perm1
Name: PPARGC1 and ESRR induced regulator, muscle 1
Synonyms: 2310042D19Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 74183
Homologene: 135954
Dis3l
Name: DIS3 like exosome 3'-5' exoribonuclease
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 213550
Homologene: 15797
Slc7a4
Name: solute carrier family 7 (cationic amino acid transporter, y+ system), member 4
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 224022
Homologene: 20883
Ifi206
Name: interferon activated gene 206
Synonyms: Gm4955, Pyblhin-C
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 102639543
HGNC: HGNC:5395
Homologene: 115929
Vmn1r170
Name: vomeronasal 1 receptor 170
Synonyms: Gm5999
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 546944
Homologene: 128341
Slc6a19
Name: solute carrier family 6 (neurotransmitter transporter), member 19
Synonyms: B0AT1, 4632401C08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 74338
Homologene: 52819
Wt1
Name: WT1 transcription factor
Synonyms: Wt-1, D630046I19Rik, Wilms tumor 1 homolog
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22431
Homologene: 11536
Sec14l3
Name: SEC14-like lipid binding 3
Synonyms: 1110069O07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380683
Homologene: 24848
Krt2
Name: keratin 2
Synonyms: Krt2-2, Krt2e, Krt2-17
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16681
HGNC: HGNC:6439
Tyms
Name: thymidylate synthase
Synonyms: TS
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 22171
Homologene: 834
Mapk8ip1
Name: mitogen-activated protein kinase 8 interacting protein 1
Synonyms: JIP-1, MAPK8IP1, IB1, Prkm8ip, mjip-2a, Skip, Jip1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 19099
HGNC: HGNC:6882
Homologene: 31314
C9
Name: complement component 9
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12279
HGNC: HGNC:1358
Homologene: 74406
Zfp229
Name: zinc finger protein 229
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 381067
Homologene: 136287
Igfbp1
Name: insulin-like growth factor binding protein 1
Synonyms: IGFBP-1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 16006
HGNC: HGNC:5469
Homologene: 498
Lcmt2
Name: leucine carboxyl methyltransferase 2
Synonyms: Tyw4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329504
Homologene: 19642
Or52n2
Name: olfactory receptor family 52 subfamily N member 2
Synonyms: GA_x6K02T2PBJ9-7522449-7521493, MOR34-1, Olfr666
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259100
Homologene: 64956
Apba2
Name: amyloid beta precursor protein binding family A member 2
Synonyms: X11-like, X11L, Mint 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 11784
HGNC: HGNC:579
Homologene: 4021
Dus2
Name: dihydrouridine synthase 2
Synonyms: 2310016K04Rik, Dus2l
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 66369
Homologene: 6838
Slc26a1
Name: solute carrier family 26 (sulfate transporter), member 1
Synonyms: Sat1
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 231583
Homologene: 32539
Gtf2a1l
Name: general transcription factor IIA, 1-like
Synonyms: 1700011N16Rik, Alf, Gtf2a1lf
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 71828
Homologene: 86732
Apol7e
Name: apolipoprotein L 7e
Synonyms: ENSMUSG00000071716
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 666348
VEGA: 15
HGNC: HGNC:619
Homologene: 40940
Mup15
Name: major urinary protein 15
Synonyms: Gm2068
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 100039150
Homologene: 74304
Apol11b
Name: apolipoprotein L 11b
Synonyms: A330102K04Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 328563
Homologene: 129975
Prox2
Name: prospero homeobox 2
Synonyms: 1700058C01Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 73422
Homologene: 18421
Timm22
Name: translocase of inner mitochondrial membrane 22
Synonyms: 2610511O07Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 56322
Homologene: 32173
Or1j8
Name: olfactory receptor family 1 subfamily J member 8
Synonyms: GA_x6K02T2NLDC-33001193-33002131, MOR137-2, Olfr335-ps
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 666118
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 60,464,604 bp
  • T to C, chromosome 1 at 74,576,227 bp
  • T to G, chromosome 1 at 173,486,643 bp
  • T to C, chromosome 2 at 35,036,347 bp
  • T to C, chromosome 2 at 36,301,934 bp
  • A to G, chromosome 2 at 65,730,278 bp
  • A to G, chromosome 2 at 67,510,898 bp
  • T to C, chromosome 2 at 76,709,308 bp
  • A to G, chromosome 2 at 92,387,254 bp
  • T to A, chromosome 2 at 105,163,366 bp
  • G to A, chromosome 2 at 118,420,835 bp
  • T to C, chromosome 2 at 118,638,403 bp
  • G to A, chromosome 2 at 121,140,041 bp
  • T to C, chromosome 2 at 122,318,490 bp
  • T to A, chromosome 2 at 154,504,565 bp
  • T to A, chromosome 2 at 167,055,955 bp
  • T to C, chromosome 3 at 37,012,621 bp
  • A to T, chromosome 3 at 55,480,431 bp
  • A to C, chromosome 3 at 144,807,314 bp
  • G to C, chromosome 4 at 42,971,740 bp
  • CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC to CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC, chromosome 4 at 43,177,312 bp
  • T to C, chromosome 4 at 61,439,638 bp
  • A to G, chromosome 4 at 156,218,582 bp
  • T to C, chromosome 5 at 14,857,051 bp
  • A to T, chromosome 5 at 30,063,362 bp
  • A to T, chromosome 5 at 32,867,977 bp
  • T to C, chromosome 5 at 36,602,635 bp
  • G to T, chromosome 5 at 108,671,594 bp
  • T to C, chromosome 5 at 129,179,637 bp
  • A to G, chromosome 5 at 137,758,166 bp
  • A to G, chromosome 5 at 145,207,609 bp
  • T to C, chromosome 6 at 71,607,450 bp
  • A to G, chromosome 7 at 23,606,869 bp
  • T to C, chromosome 7 at 25,272,695 bp
  • A to T, chromosome 7 at 42,661,989 bp
  • A to G, chromosome 7 at 44,739,547 bp
  • T to C, chromosome 7 at 64,743,390 bp
  • C to T, chromosome 7 at 104,893,318 bp
  • C to T, chromosome 7 at 116,358,704 bp
  • T to C, chromosome 8 at 71,358,985 bp
  • T to C, chromosome 8 at 106,044,875 bp
  • A to C, chromosome 9 at 15,919,199 bp
  • A to G, chromosome 9 at 64,329,547 bp
  • T to G, chromosome 9 at 99,875,509 bp
  • C to T, chromosome 9 at 108,094,410 bp
  • A to T, chromosome 11 at 4,076,324 bp
  • A to G, chromosome 11 at 7,197,881 bp
  • A to G, chromosome 11 at 76,407,370 bp
  • T to A, chromosome 11 at 82,812,438 bp
  • G to A, chromosome 11 at 102,288,327 bp
  • A to T, chromosome 11 at 116,059,209 bp
  • G to A, chromosome 11 at 116,543,997 bp
  • G to A, chromosome 12 at 85,094,992 bp
  • A to G, chromosome 13 at 3,888,518 bp
  • A to G, chromosome 13 at 18,829,226 bp
  • T to C, chromosome 13 at 73,685,911 bp
  • T to A, chromosome 13 at 100,219,830 bp
  • T to C, chromosome 13 at 100,223,313 bp
  • A to T, chromosome 13 at 102,705,978 bp
  • A to G, chromosome 13 at 106,968,738 bp
  • C to T, chromosome 13 at 113,045,591 bp
  • A to G, chromosome 14 at 70,668,700 bp
  • T to C, chromosome 15 at 6,459,581 bp
  • T to C, chromosome 15 at 59,344,131 bp
  • C to T, chromosome 15 at 77,640,571 bp
  • C to T, chromosome 15 at 77,717,733 bp
  • T to C, chromosome 15 at 83,629,404 bp
  • T to C, chromosome 15 at 101,816,489 bp
  • A to G, chromosome 16 at 17,575,398 bp
  • A to T, chromosome 16 at 20,154,152 bp
  • A to G, chromosome 16 at 58,999,865 bp
  • T to C, chromosome 17 at 21,745,592 bp
  • A to G, chromosome 17 at 30,998,169 bp
  • T to A, chromosome 17 at 45,568,952 bp
  • A to G, chromosome 17 at 88,694,520 bp
  • T to C, chromosome 18 at 37,443,100 bp
  • A to T, chromosome 19 at 46,320,278 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9569 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068966-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.