Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9569Btlr/Mmmh
Stock Number:
068966-MU
Citation ID:
RRID:MMRRC_068966-MU
Other Names:
R9569 (G1)
Major Collection:

Strain Information

Vps41
Name: VPS41 HOPS complex subunit
Synonyms: Vam2, mVam2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218035
VEGA: 13
Homologene: 69165
Cbfa2t2
Name: CBFA2/RUNX1 translocation partner 2
Synonyms: MTGR1, C330013D05Rik, Cbfa2t2h
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 12396
HGNC: HGNC:1536
Homologene: 3733
Hsp90ab1
Name: heat shock protein 90 alpha (cytosolic), class B member 1
Synonyms: Hsp84, Hsp90, Hsp84-1, C81438, Hspcb
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 15516
Homologene: 74306
Kif2a
Name: kinesin family member 2A
Synonyms: Kns2, Kif2, M-kinesin
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 16563
HGNC: HGNC:6318
Homologene: 3320
Kdm3a
Name: lysine (K)-specific demethylase 3A
Synonyms: 1700105C21Rik, Tsga, C230043E16Rik, Jmjd1, Jmjd1a
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 104263
Homologene: 10196
Pik3c2a
Name: phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha
Synonyms: PI3KC2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 18704
HGNC: HGNC:8971
Homologene: 20581
Ube2o
Name: ubiquitin-conjugating enzyme E2O
Synonyms: B230113M03Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 217342
Homologene: 11113
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • T to A, chromosome 1 at 60,464,604 bp
  • T to C, chromosome 1 at 74,576,227 bp
  • T to G, chromosome 1 at 173,486,643 bp
  • T to C, chromosome 2 at 35,036,347 bp
  • T to C, chromosome 2 at 36,301,934 bp
  • A to G, chromosome 2 at 65,730,278 bp
  • A to G, chromosome 2 at 67,510,898 bp
  • T to C, chromosome 2 at 76,709,308 bp
  • A to G, chromosome 2 at 92,387,254 bp
  • T to A, chromosome 2 at 105,163,366 bp
  • G to A, chromosome 2 at 118,420,835 bp
  • T to C, chromosome 2 at 118,638,403 bp
  • G to A, chromosome 2 at 121,140,041 bp
  • T to C, chromosome 2 at 122,318,490 bp
  • T to A, chromosome 2 at 154,504,565 bp
  • T to A, chromosome 2 at 167,055,955 bp
  • T to C, chromosome 3 at 37,012,621 bp
  • A to T, chromosome 3 at 55,480,431 bp
  • A to C, chromosome 3 at 144,807,314 bp
  • G to C, chromosome 4 at 42,971,740 bp
  • CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC to CGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGCCAGAGC, chromosome 4 at 43,177,312 bp
  • T to C, chromosome 4 at 61,439,638 bp
  • A to G, chromosome 4 at 156,218,582 bp
  • T to C, chromosome 5 at 14,857,051 bp
  • A to T, chromosome 5 at 30,063,362 bp
  • A to T, chromosome 5 at 32,867,977 bp
  • T to C, chromosome 5 at 36,602,635 bp
  • G to T, chromosome 5 at 108,671,594 bp
  • T to C, chromosome 5 at 129,179,637 bp
  • A to G, chromosome 5 at 137,758,166 bp
  • A to G, chromosome 5 at 145,207,609 bp
  • T to C, chromosome 6 at 71,607,450 bp
  • A to G, chromosome 7 at 23,606,869 bp
  • T to C, chromosome 7 at 25,272,695 bp
  • A to T, chromosome 7 at 42,661,989 bp
  • A to G, chromosome 7 at 44,739,547 bp
  • T to C, chromosome 7 at 64,743,390 bp
  • C to T, chromosome 7 at 104,893,318 bp
  • C to T, chromosome 7 at 116,358,704 bp
  • T to C, chromosome 8 at 71,358,985 bp
  • T to C, chromosome 8 at 106,044,875 bp
  • A to C, chromosome 9 at 15,919,199 bp
  • A to G, chromosome 9 at 64,329,547 bp
  • T to G, chromosome 9 at 99,875,509 bp
  • C to T, chromosome 9 at 108,094,410 bp
  • A to T, chromosome 11 at 4,076,324 bp
  • A to G, chromosome 11 at 7,197,881 bp
  • A to G, chromosome 11 at 76,407,370 bp
  • T to A, chromosome 11 at 82,812,438 bp
  • G to A, chromosome 11 at 102,288,327 bp
  • A to T, chromosome 11 at 116,059,209 bp
  • G to A, chromosome 11 at 116,543,997 bp
  • G to A, chromosome 12 at 85,094,992 bp
  • A to G, chromosome 13 at 3,888,518 bp
  • A to G, chromosome 13 at 18,829,226 bp
  • T to C, chromosome 13 at 73,685,911 bp
  • T to A, chromosome 13 at 100,219,830 bp
  • T to C, chromosome 13 at 100,223,313 bp
  • A to T, chromosome 13 at 102,705,978 bp
  • A to G, chromosome 13 at 106,968,738 bp
  • C to T, chromosome 13 at 113,045,591 bp
  • A to G, chromosome 14 at 70,668,700 bp
  • T to C, chromosome 15 at 6,459,581 bp
  • T to C, chromosome 15 at 59,344,131 bp
  • C to T, chromosome 15 at 77,640,571 bp
  • C to T, chromosome 15 at 77,717,733 bp
  • T to C, chromosome 15 at 83,629,404 bp
  • T to C, chromosome 15 at 101,816,489 bp
  • A to G, chromosome 16 at 17,575,398 bp
  • A to T, chromosome 16 at 20,154,152 bp
  • A to G, chromosome 16 at 58,999,865 bp
  • T to C, chromosome 17 at 21,745,592 bp
  • A to G, chromosome 17 at 30,998,169 bp
  • T to A, chromosome 17 at 45,568,952 bp
  • A to G, chromosome 17 at 88,694,520 bp
  • T to C, chromosome 18 at 37,443,100 bp
  • A to T, chromosome 19 at 46,320,278 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
The MMRRC Centers have developed a Strain GQC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC strains. For more information on whether data may be available, or to request genotyping for a strain of interest, please contact MMRRC_GeneticQC@med.unc.edu. Older strains may not have this information available.
Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9569 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068966-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.