Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9106Btlr/Mmmh
Stock Number:
068970-MU
Citation ID:
RRID:MMRRC_068970-MU
Other Names:
R9106 (G1)
Major Collection:

Strain Information

Ptk2
Name: PTK2 protein tyrosine kinase 2
Synonyms: Fadk, FAK, FRNK
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 14083
VEGA: 15
HGNC: HGNC:9611
Homologene: 7314
Ubp1
Name: upstream binding protein 1
Synonyms: NF2d9, LBP-1b, LBP-1a
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 22221
VEGA: 9
Homologene: 8435
Cnst
Name: consortin, connexin sorting protein
Synonyms: 9630058J23Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226744
Homologene: 17139
Usp47
Name: ubiquitin specific peptidase 47
Synonyms: 4930502N04Rik, A630020C16Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74996
Homologene: 9929
Mapkapk3
Name: mitogen-activated protein kinase-activated protein kinase 3
Synonyms: MK3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102626
HGNC: HGNC:6888
Homologene: 55836
Ssr2
Name: signal sequence receptor, beta
Synonyms: TRAPbeta
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 66256
Homologene: 2369
Trim36
Name: tripartite motif-containing 36
Synonyms: D18Wsu100e, Haprin
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 28105
VEGA: 18
Homologene: 10275
Genetic Alterations
ENU-induced transitions at the following base pair locations (GRCm38):
  • A to G, chromosome 1 at 6,248,885 bp
  • T to C, chromosome 1 at 28,776,894 bp
  • C to A, chromosome 1 at 57,998,124 bp
  • T to A, chromosome 1 at 66,415,363 bp
  • T to C, chromosome 1 at 74,394,725 bp
  • T to C, chromosome 1 at 93,561,188 bp
  • A to G, chromosome 1 at 174,158,803 bp
  • A to G, chromosome 1 at 179,604,597 bp
  • C to A, chromosome 1 at 179,787,036 bp
  • A to G, chromosome 2 at 25,596,434 bp
  • A to G, chromosome 2 at 88,794,672 bp
  • C to A, chromosome 3 at 28,902,291 bp
  • T to A, chromosome 3 at 88,587,962 bp
  • T to G, chromosome 4 at 3,871,457 bp
  • G to A, chromosome 4 at 126,577,450 bp
  • A to G, chromosome 4 at 129,084,147 bp
  • T to C, chromosome 5 at 5,640,190 bp
  • C to T, chromosome 5 at 36,616,338 bp
  • A to T, chromosome 5 at 103,038,576 bp
  • G to A, chromosome 5 at 112,378,039 bp
  • T to C, chromosome 5 at 113,754,349 bp
  • T to A, chromosome 5 at 120,530,351 bp
  • C to A, chromosome 5 at 121,329,556 bp
  • T to A, chromosome 5 at 123,615,160 bp
  • T to C, chromosome 6 at 73,144,769 bp
  • A to G, chromosome 6 at 141,672,248 bp
  • T to C, chromosome 6 at 149,328,870 bp
  • A to G, chromosome 7 at 12,991,170 bp
  • G to T, chromosome 7 at 26,382,412 bp
  • A to T, chromosome 7 at 42,046,460 bp
  • A to G, chromosome 7 at 48,198,931 bp
  • T to C, chromosome 7 at 88,074,539 bp
  • G to A, chromosome 7 at 103,717,530 bp
  • A to T, chromosome 7 at 103,979,374 bp
  • T to C, chromosome 7 at 112,082,506 bp
  • T to G, chromosome 8 at 57,532,695 bp
  • A to G, chromosome 8 at 77,549,729 bp
  • A to T, chromosome 8 at 121,978,633 bp
  • C to T, chromosome 9 at 42,367,183 bp
  • A to G, chromosome 9 at 49,517,556 bp
  • C to A, chromosome 9 at 71,721,591 bp
  • T to A, chromosome 9 at 107,258,868 bp
  • A to G, chromosome 9 at 113,970,251 bp
  • T to C, chromosome 9 at 120,432,478 bp
  • A to G, chromosome 11 at 17,194,789 bp
  • A to G, chromosome 11 at 50,174,941 bp
  • T to C, chromosome 11 at 83,212,632 bp
  • GGTTCTTCAGTGT to GGT, chromosome 11 at 120,629,589 bp
  • T to C, chromosome 12 at 84,152,553 bp
  • C to T, chromosome 12 at 103,604,056 bp
  • T to C, chromosome 13 at 23,478,295 bp
  • G to A, chromosome 14 at 37,054,934 bp
  • T to C, chromosome 15 at 73,259,608 bp
  • G to T, chromosome 15 at 75,269,857 bp
  • C to A, chromosome 15 at 76,305,676 bp
  • AGCCGCTGCCGCTGCCGCTGCCGC to AGCCGCTGCCGCTGCCGC, chromosome 15 at 99,946,226 bp
  • A to G, chromosome 16 at 15,848,704 bp
  • T to C, chromosome 16 at 45,860,394 bp
  • A to T, chromosome 16 at 64,926,274 bp
  • A to T, chromosome 17 at 7,931,448 bp
  • G to A, chromosome 17 at 78,626,849 bp
  • C to A, chromosome 17 at 80,727,828 bp
  • A to T, chromosome 18 at 7,294,527 bp
  • A to T, chromosome 18 at 46,167,597 bp
  • A to T, chromosome 18 at 61,046,028 bp
  • A to G, chromosome 19 at 11,931,609 bp
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9106 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
068970-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.