Strain Name:
C57BL/6J-MtgxR9115Btlr/Mmmh
Stock Number:
069003-MU
Citation ID:
RRID:MMRRC_069003-MU
Other Names:
R9115 (G1)
Major Collection:

Strain Information

Sptbn1
Name: spectrin beta, non-erythrocytic 1
Synonyms: 9930031C03Rik, brain spectrin, elf1, spectrin G, beta fodrin, Spnb2, non-erythrocytic, Spnb-2, elf3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20742
Homologene: 2354
Nmu
Name: neuromedin U
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56183
HGNC: HGNC:7859
Homologene: 4863
Slc37a1
Name: solute carrier family 37 (glycerol-3-phosphate transporter), member 1
Synonyms: G3PP
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224674
VEGA: 17
Homologene: 70486
Usp5
Name: ubiquitin specific peptidase 5 (isopeptidase T)
Synonyms: Ucht
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 22225
Homologene: 55758
Virma
Name: vir like m6A methyltransferase associated
Synonyms: 1110037F02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 66185
Homologene: 41043
Brwd1
Name: bromodomain and WD repeat domain containing 1
Synonyms: Wdr9, D530019K20Rik, G1-403-16, 5330419I02Rik, repro5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 93871
Homologene: 23130
Yars1
Name: tyrosyl-tRNA synthetase 1
Synonyms: Yars
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 107271
Homologene: 2730
Eef2
Name: eukaryotic translation elongation factor 2
Synonyms: Ef-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13629
VEGA: 10
HGNC: HGNC:3214
Homologene: 134867
Gfm2
Name: G elongation factor, mitochondrial 2
Synonyms: EFG2, A930009M04Rik, MST027, 6530419G12Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 320806
Homologene: 6238
Sema4d
Name: sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
Synonyms: Semaj, M-sema G, CD100, semaphorin H, Semacl2, coll-4, Semcl2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20354
Homologene: 21282
Pgm3
Name: phosphoglucomutase 3
Synonyms: 2810473H05Rik, Pgm-3, GlcNAc-P mutase
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 109785
HGNC: HGNC:8907
Homologene: 9205
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Cftr
Name: cystic fibrosis transmembrane conductance regulator
Synonyms: Abcc7
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 12638
HGNC: HGNC:1884
Homologene: 55465
Capns1
Name: calpain, small subunit 1
Synonyms: Capa4, D7Ertd146e, Capn4, Capa-4
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 12336
HGNC: HGNC:1481
Homologene: 1327
Hjurp
Name: Holliday junction recognition protein
Synonyms: 6430706D22Rik, A730008H23Rik, C330011F01Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Muc15
Name: mucin 15
Synonyms: D730046L02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 269328
Homologene: 51680
Uimc1
Name: ubiquitin interaction motif containing 1
Synonyms: Rxrip110, D630032M02Rik, D330018D10Rik, 9430016E08Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20184
Homologene: 9455
Zmynd11
Name: zinc finger, MYND domain containing 11
Synonyms: 2210402G22Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 66505
Homologene: 4828
Klhl26
Name: kelch-like 26
Synonyms: C630013N10Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234378
Homologene: 41247
Nr2f1
Name: nuclear receptor subfamily 2, group F, member 1
Synonyms: COUP-TF1, Tcfcoup1, Erbal3, COUP-TFI
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 13865
HGNC: HGNC:7975
Homologene: 21158
Lrrc4c
Name: leucine rich repeat containing 4C
Synonyms: 6430556C10Rik, netrin g1 ligand, NGL-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241568
Homologene: 18696
Ryr1
Name: ryanodine receptor 1, skeletal muscle
Synonyms: Ryr, skrr, calcium release channel isoform 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20190
Homologene: 68069
Ckap4
Name: cytoskeleton-associated protein 4
Synonyms: 5630400A09Rik, CLIMP-63, P63
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216197
VEGA: 10
Homologene: 4970
Ttn
Name: titin
Synonyms: shru, L56, mdm, connectin, D330041I19Rik, 2310057K23Rik, 2310074I15Rik, 2310036G12Rik, D830007G01Rik, 1100001C23Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Celsr1
Name: cadherin, EGF LAG seven-pass G-type receptor 1
Synonyms: crash, Adgrc1, Crsh, Scy
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12614
VEGA: 15
HGNC: HGNC:1850
Homologene: 7665
Col27a1
Name: collagen, type XXVII, alpha 1
Synonyms: 5730512J02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 373864
Homologene: 69400
Dock10
Name: dedicator of cytokinesis 10
Synonyms: A630054M16Rik, Zizimin3, Jr5, Jr4, ZIZ3, 9330153B10Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210293
Homologene: 45952
Gm12695
Name: predicted gene 12695
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 620779
Homologene: 51847
Fcgbpl1
Name: Fc fragment of IgG binding protein like 1
Synonyms: 9530053A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319482
Homologene: 130055
Fshr
Name: follicle stimulating hormone receptor
Synonyms: FSH-R, Follitropin receptor, follicle-stimulating hormone receptor
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 14309
VEGA: 17
HGNC: HGNC:3969
Homologene: 117
Cspg4
Name: chondroitin sulfate proteoglycan 4
Synonyms: Cspg4a, AN2, 4732461B14Rik, NG2
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 121021
VEGA: 9
HGNC: HGNC:2466
Homologene: 20445
Vmn2r85
Name: vomeronasal 2, receptor 85
Synonyms: EG623734
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 623734
Homologene: 129606
Zfp712
Name: zinc finger protein 712
Synonyms: mszf89, mszf31, 4921504N20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78251
VEGA: 13
Homologene: 136296
Tecrl
Name: trans-2,3-enoyl-CoA reductase-like
Synonyms: Srd5a2l2, D330017N19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 243078
Homologene: 27549
Zfp235
Name: zinc finger protein 235
Synonyms: 0610030O19Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 56525
Homologene: 122146
Or8h8
Name: olfactory receptor family 8 subfamily H member 8
Synonyms: Olfr1098, MOR206-1, GA_x6K02T2Q125-48410458-48409511
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258842
Homologene: 37005
Ntn4
Name: netrin 4
Synonyms: beta-netrin
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 57764
Homologene: 10934
Cyp4f39
Name: cytochrome P450, family 4, subfamily f, polypeptide 39
Synonyms: 4732474A20Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 320997
VEGA: 17
Homologene: 69814
Nol4l
Name: nucleolar protein 4-like
Synonyms: LOC381396, 8430427H17Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 329540
Homologene: 129589
Or52h2
Name: olfactory receptor family 52 subfamily H member 2
Synonyms: MOR31-7, GA_x6K02T2PBJ9-6924585-6923647, Olfr649
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259057
Homologene: 74119
Rbm12
Name: RNA binding motif protein 12
Synonyms: SWAN, 9430070C08Rik, 5730420G12Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 75710
HGNC: HGNC:9898
Homologene: 34993
Mfsd4b3-ps
Name: major facilitator superfamily domain containing 4B3, pseudogene
Synonyms: G630090E17Rik, Mfsd4b3
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100041085
Homologene: 136347
Pccb
Name: propionyl Coenzyme A carboxylase, beta polypeptide
Synonyms: 1300012P06Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 66904
HGNC: HGNC:8654
Homologene: 447
Mapk10
Name: mitogen-activated protein kinase 10
Synonyms: Serk2, p493F12, C230008H04Rik, JNK3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 26414
HGNC: HGNC:6872
Homologene: 56439
Ccdc182
Name: coiled-coil domain containing 182
Synonyms: 1700106J16Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 74297
Homologene: 87544
Prkra
Name: protein kinase, interferon inducible double stranded RNA dependent activator
Synonyms: PRK, RAX, lear, Pact
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 23992
HGNC: HGNC:9438
Homologene: 2738
Tdrkh
Name: tudor and KH domain containing protein
Synonyms: 2700091C21Rik, Tdrd2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 72634
Homologene: 4999
Tcstv1a
Name: 2 cell stage variable group member 1A
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 54382
Gm5930
Name: predicted gene 5930
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 546250
Or12k7
Name: olfactory receptor family 12 subfamily K member 7
Synonyms: GA_x6K02T2NLDC-33760081-33761034, MOR159-1, Olfr360
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258615
Homologene: 73997
Ankrd31
Name: ankyrin repeat domain 31
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 625662
Homologene: 110355
Krtap10-24
Name: keratin associated protein 10-24
Synonyms: Gm3285
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 100041351
VEGA: 10
Homologene: 115744
Nxt2
Name: nuclear transport factor 2-like export factor 2
Synonyms: P15-2, 6330587F24Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 237082
Homologene: 10273
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 80,512,439 bp (GRCm38)
  • CTCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCT to C, chromosome 1 at 88,266,277 bp (GRCm38)
  • T to C, chromosome 2 at 37,069,040 bp (GRCm38)
  • T to A, chromosome 2 at 76,647,849 bp (GRCm38)
  • T to C, chromosome 2 at 76,950,152 bp (GRCm38)
  • T to A, chromosome 2 at 86,922,654 bp (GRCm38)
  • T to C, chromosome 2 at 97,629,341 bp (GRCm38)
  • C to T, chromosome 2 at 110,731,744 bp (GRCm38)
  • G to T, chromosome 2 at 153,411,718 bp (GRCm38)
  • TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC to TATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCGGGCATTGCGGGACCAGGCATTGCGGGACC, chromosome 2 at 156,096,110 bp (GRCm38)
  • G to T, chromosome 3 at 94,428,291 bp (GRCm38)
  • A to G, chromosome 4 at 11,498,744 bp (GRCm38)
  • C to T, chromosome 4 at 63,313,737 bp (GRCm38)
  • T to C, chromosome 4 at 96,769,609 bp (GRCm38)
  • T to C, chromosome 4 at 129,215,350 bp (GRCm38)
  • G to A, chromosome 5 at 76,363,725 bp (GRCm38)
  • A to T, chromosome 5 at 83,280,059 bp (GRCm38)
  • A to T, chromosome 5 at 103,038,666 bp (GRCm38)
  • A to T, chromosome 6 at 18,235,311 bp (GRCm38)
  • A to G, chromosome 6 at 124,826,421 bp (GRCm38)
  • G to A, chromosome 7 at 24,142,028 bp (GRCm38)
  • G to A, chromosome 7 at 28,154,329 bp (GRCm38)
  • T to A, chromosome 7 at 29,104,564 bp (GRCm38)
  • A to T, chromosome 7 at 30,190,553 bp (GRCm38)
  • C to A, chromosome 7 at 104,189,724 bp (GRCm38)
  • A to G, chromosome 8 at 70,452,246 bp (GRCm38)
  • T to C, chromosome 9 at 54,401,727 bp (GRCm38)
  • T to C, chromosome 9 at 56,890,452 bp (GRCm38)
  • G to A, chromosome 9 at 86,565,609 bp (GRCm38)
  • T to A, chromosome 9 at 100,987,855 bp (GRCm38)
  • T to A, chromosome 10 at 39,948,016 bp (GRCm38)
  • T to A, chromosome 10 at 77,862,173 bp (GRCm38)
  • T to C, chromosome 10 at 78,043,475 bp (GRCm38)
  • CC to CCC, chromosome 10 at 81,178,769 bp (GRCm38)
  • C to T, chromosome 10 at 84,527,643 bp (GRCm38)
  • A to C, chromosome 10 at 93,733,813 bp (GRCm38)
  • A to G, chromosome 10 at 130,418,284 bp (GRCm38)
  • A to G, chromosome 11 at 30,137,526 bp (GRCm38)
  • A to G, chromosome 11 at 88,294,517 bp (GRCm38)
  • A to T, chromosome 13 at 9,693,459 bp (GRCm38)
  • A to T, chromosome 13 at 51,723,560 bp (GRCm38)
  • A to T, chromosome 13 at 55,050,771 bp (GRCm38)
  • A to T, chromosome 13 at 67,041,177 bp (GRCm38)
  • A to G, chromosome 13 at 78,189,750 bp (GRCm38)
  • T to C, chromosome 13 at 96,804,265 bp (GRCm38)
  • T to C, chromosome 13 at 97,165,199 bp (GRCm38)
  • T to A, chromosome 13 at 119,893,917 bp (GRCm38)
  • A to T, chromosome 14 at 44,337,549 bp (GRCm38)
  • A to G, chromosome 15 at 85,919,016 bp (GRCm38)
  • C to T, chromosome 16 at 96,047,114 bp (GRCm38)
  • T to C, chromosome 17 at 31,315,512 bp (GRCm38)
  • T to A, chromosome 17 at 32,492,322 bp (GRCm38)
  • T to A, chromosome 17 at 88,985,520 bp (GRCm38)
  • C to T, chromosome X at 142,237,751 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9115 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069003-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.