Strain Name:
C57BL/6J-MtgxR9138Btlr/Mmmh
Stock Number:
069012-MU
Citation ID:
RRID:MMRRC_069012-MU
Other Names:
R9138 (G1)
Major Collection:

Strain Information

Zmpste24
Name: zinc metallopeptidase, STE24
Synonyms: A530043O15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230709
Homologene: 4277
Angpt2
Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11601
HGNC: HGNC:485
Homologene: 22401
Chrna4
Name: cholinergic receptor, nicotinic, alpha polypeptide 4
Synonyms: Acra-4, alpha4 nAChR, alpha4-nAChR, a4 nicotinic receptor, Acra4
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11438
HGNC: HGNC:1958
Homologene: 592
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Gprc5a
Name: G protein-coupled receptor, family C, group 5, member A
Synonyms: Gprc5a, Rai3, Raig1
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232431
HGNC: HGNC:9836
Homologene: 2961
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Septin7
Name: septin 7
Synonyms: Cdc10, Sept7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235072
VEGA: 9
HGNC: HGNC:1717
Homologene: 1354
Bltp3b
Name: bridge-like lipid transfer protein family member 3B
Synonyms: 4930506D01Rik, E030041M21Rik, Uhrf1bp1l, 2010319N22Rik
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 75089
VEGA: 10
Homologene: 12590
Mtf1
Name: metal response element binding transcription factor 1
Synonyms: metal response element-binding transcription factor 1, Thyls, metalloregulatory transcription factor, MTF-1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 17764
HGNC: HGNC:7428
Homologene: 4347
Stag1
Name: STAG1 cohesin complex component
Synonyms: Scc3, SA-1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20842
Homologene: 21191
Taf2
Name: TATA-box binding protein associated factor 2
Synonyms: CIF150, 150kDa, TAFII150, TAF2B, 4732460C16Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 319944
VEGA: 15
Homologene: 31137
Ddias
Name: DNA damage-induced apoptosis suppressor
Synonyms: 4632434I11Rik, noxin
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 74041
Homologene: 51655
Naf1
Name: nuclear assembly factor 1 ribonucleoprotein
Synonyms: LOC234344
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234344
Homologene: 128518
Son
Name: Son DNA binding protein
Synonyms: 2900011L12Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 20658
Homologene: 10551
Lrrfip1
Name: leucine rich repeat (in FLII) interacting protein 1
Synonyms: FLAP (FLI LRR associated protein), Fliiap1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16978
HGNC: HGNC:6702
Homologene: 48301
Phf11d
Name: PHD finger protein 11D
Synonyms: D14Ertd668e
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 219132
Homologene: 87807
Dab1
Name: disabled 1
Synonyms: C630028C02Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 13131
HGNC: HGNC:2661
Homologene: 32084
Upf2
Name: UPF2 regulator of nonsense transcripts homolog (yeast)
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 326622
Homologene: 6101
Cdh9
Name: cadherin 9
Synonyms: T1-cadherin
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 12565
HGNC: HGNC:1768
Homologene: 9450
Rasa1
Name: RAS p21 protein activator 1
Synonyms: Gap, p120-rasGAP
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218397
HGNC: HGNC:9871
Homologene: 2168
Mcm4
Name: minichromosome maintenance complex component 4
Synonyms: Cdc21, mCdc21, Mcmd4, 19G
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 17217
VEGA: 16
HGNC: HGNC:6947
Homologene: 40496
Dpf2
Name: double PHD fingers 2
Synonyms: Req, ubi-d4, 2210010M07Rik, Baf45d, requiem
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 19708
HGNC: HGNC:9964
Homologene: 21265
Tax1bp1
Name: Tax1 (human T cell leukemia virus type I) binding protein 1
Synonyms: 1200003J11Rik, D6Ertd772e, T6BP, TXBP151, D6Ertd404e, 1700069J21Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 52440
Homologene: 4395
Adgre5
Name: adhesion G protein-coupled receptor E5
Synonyms: Cd97, EGF-TM7 receptor
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 26364
Homologene: 8050
Gmds
Name: GDP-mannose 4, 6-dehydratase
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 218138
HGNC: HGNC:4369
Homologene: 75968
Peak1
Name: pseudopodium-enriched atypical kinase 1
Synonyms: 1110049L02Rik, C230081A13Rik, NKF3 kinase family member
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 244895
Homologene: 18259
Nbeal1
Name: neurobeachin like 1
Synonyms: A530050O19Rik, 2310076G13Rik, ALS2CR17, A530083I02Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 269198
Homologene: 16453
Lct
Name: lactase
Synonyms: LOC226413, LPH, Lphl
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 226413
HGNC: HGNC:6530
Homologene: 124204
Idh2
Name: isocitrate dehydrogenase 2 (NADP+), mitochondrial
Synonyms: IDPm, Idh-2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 269951
HGNC: HGNC:5383
Homologene: 37590
Crb1
Name: crumbs family member 1, photoreceptor morphogenesis associated
Synonyms: 7530426H14Rik, A930008G09Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 170788
HGNC: HGNC:2343
Homologene: 8092
Pkd1l3
Name: polycystic kidney disease 1 like 3
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 244646
Homologene: 14627
Col11a2
Name: collagen, type XI, alpha 2
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 12815
HGNC: HGNC:2187
Homologene: 22547
Ptpro
Name: protein tyrosine phosphatase receptor type O
Synonyms: PTP-BK, PTPROt, GLEPP1, Ptpn15, PTP-U2, PTP-phi, D28, PTP-oc
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 19277
HGNC: HGNC:9678
Homologene: 21564
Spata31e2
Name: spermatogenesis associated 31 subfamily E member 2
Synonyms: 4931408C20Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 210940
Homologene: 86827
Ap4b1
Name: adaptor-related protein complex AP-4, beta 1
Synonyms: AP-4 beta-4, 1810038H16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 67489
HGNC: HGNC:572
Homologene: 38203
Arhgap5
Name: Rho GTPase activating protein 5
Synonyms: p190-B, p190B
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 11855
VEGA: 12
HGNC: HGNC:675
Homologene: 907
Abcb9
Name: ATP-binding cassette, sub-family B member 9
Synonyms: TAPL
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 56325
HGNC: HGNC:50
Homologene: 10491
Ankhd1
Name: ankyrin repeat and KH domain containing 1
Synonyms: 9130019P20Rik, 4933432B13Rik, A530027J04Rik, 1110004O12Rik
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 108857
Homologene: 87006
Slco3a1
Name: solute carrier organic anion transporter family, member 3a1
Synonyms: Slc21a11, 5830414C08Rik, MJAM, Anr1, OATP-D
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 108116
Homologene: 40862
H2bc1
Name: H2B clustered histone 1
Synonyms: Hist1h2ba
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 319177
Homologene: 69356
Zfp712
Name: zinc finger protein 712
Synonyms: 4921504N20Rik, mszf89, mszf31
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 78251
VEGA: 13
Homologene: 136296
Mdga2
Name: MAM domain containing glycosylphosphatidylinositol anchor 2
Synonyms: Mdga2, 6720489L24Rik, Adp, 9330209L04Rik, Mamdc1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 320772
Homologene: 45659
Cps1
Name: carbamoyl-phosphate synthetase 1
Synonyms: D1Ucla3, 4732433M03Rik, CPSase I, CPS
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227231
HGNC: HGNC:2323
Homologene: 68208
Vmn2r114
Name: vomeronasal 2, receptor 114
Synonyms: EG666002
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 666002
Homologene: 86604
Dlg5
Name: discs large MAGUK scaffold protein 5
Synonyms: 4933429D20Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 71228
HGNC: HGNC:2904
Homologene: 3486
Pkd1l2
Name: polycystic kidney disease 1 like 2
Synonyms: 1700126L06Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 76645
Homologene: 124481
Ago4
Name: argonaute RISC catalytic subunit 4
Synonyms: argonaute 4, Eif2c4, 5730550L01Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 76850
Homologene: 41184
Il18rap
Name: interleukin 18 receptor accessory protein
Synonyms: AcPL accessory protein-like)
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16174
HGNC: HGNC:5989
Homologene: 2859
Psg20
Name: pregnancy-specific beta-1-glycoprotein 20
Synonyms: cea7, EG434540
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 434540
Homologene: 110989
Nxt1
Name: NTF2-related export protein 1
Synonyms: 1110001N02Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 56488
Homologene: 8301
Garin5b
Name: golgi associated RAB2 interactor family member 5B
Synonyms: Fam71e2, 4930401F20Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 243822
Homologene: 89225
Vmn1r193
Name: vomeronasal 1 receptor 193
Synonyms: V1ri9
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 171259
Homologene: 110880
Vmn2r11
Name: vomeronasal 2, receptor 11
Synonyms: EG384219
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 384219
Homologene: 129606
Tmem63c
Name: transmembrane protein 63c
Synonyms: 9330187M14Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217733
Homologene: 33129
Evi5l
Name: ecotropic viral integration site 5 like
Synonyms: 3110007G05Rik, B130050I23Rik, 2310039H16Rik, 1700084G18Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 213027
Homologene: 134635
Or5b123
Name: olfactory receptor family 5 subfamily B member 123
Synonyms: GA_x6K02T2RE5P-3951719-3952666, Olfr1487, MOR202-18
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 258629
Homologene: 110492
Ocstamp
Name: osteoclast stimulatory transmembrane protein
Synonyms: 4833422F24Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 74614
Homologene: 41768
Caln1
Name: calneuron 1
Synonyms: Cabp8, 9630012C17Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 140904
Homologene: 10966
Or1j19
Name: olfactory receptor family 1 subfamily J member 19
Synonyms: GA_x6K02T2NLDC-33481050-33481991, Olfr348, MOR136-8
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 258946
HGNC: HGNC:8209
Homologene: 105219
Mfrp
Name: membrane frizzled-related protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 259172
Homologene: 12866
Dok1
Name: docking protein 1
Synonyms: p62DOK
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 13448
HGNC: HGNC:2990
Homologene: 1057
Zfp444
Name: zinc finger protein 444
Synonyms: 2810031J10Rik, 6230401O10Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 72667
Homologene: 10139
Or4n4b
Name: olfactory receptor family 4 subfamily N member 4B
Synonyms: MOR241-2, Olfr733, GA_x6K02T2PMLR-5992342-5991416
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 258657
Homologene: 128266
Hoxd12
Name: homeobox D12
Synonyms: Hox-5.6, Hox-4.7
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15432
HGNC: HGNC:5135
Homologene: 7369
Rasa4
Name: RAS p21 protein activator 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 54153
Homologene: 5080
Gm5431
Name: predicted gene 5431
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 432555
Sertad2
Name: SERTA domain containing 2
Synonyms: SEI-2, Trip-Br2, Sei2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 58172
Homologene: 8843
Trav12-2
Name: T cell receptor alpha variable 12-2
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 100043322
Timd6
Name: T cell immunoglobulin and mucin domain containing 6
Synonyms: BC053393
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 407814
Homologene: 86792
Pcdhgc5
Name: protocadherin gamma subfamily C, 5
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 93708
HGNC: HGNC:8718
Homologene: 110933
B3galt9
Name: beta-1,3-galactosyltransferase 9
Synonyms: Gm34653
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 102637973
Homologene: 131655
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 26,682,172 bp (GRCm38)
  • C to T, chromosome 1 at 40,543,017 bp (GRCm38)
  • G to T, chromosome 1 at 60,247,745 bp (GRCm38)
  • G to A, chromosome 1 at 67,215,410 bp (GRCm38)
  • T to A, chromosome 1 at 91,110,358 bp (GRCm38)
  • T to C, chromosome 1 at 128,300,157 bp (GRCm38)
  • T to C, chromosome 1 at 139,234,730 bp (GRCm38)
  • T to A, chromosome 2 at 6,023,321 bp (GRCm38)
  • T to C, chromosome 2 at 34,838,908 bp (GRCm38)
  • A to G, chromosome 2 at 36,786,690 bp (GRCm38)
  • T to A, chromosome 2 at 74,675,558 bp (GRCm38)
  • C to A, chromosome 2 at 142,700,556 bp (GRCm38)
  • C to A, chromosome 2 at 148,675,652 bp (GRCm38)
  • T to A, chromosome 2 at 165,395,944 bp (GRCm38)
  • A to G, chromosome 2 at 181,028,982 bp (GRCm38)
  • T to A, chromosome 3 at 103,815,310 bp (GRCm38)
  • A to T, chromosome 4 at 104,731,732 bp (GRCm38)
  • T to G, chromosome 4 at 121,065,821 bp (GRCm38)
  • C to T, chromosome 4 at 124,838,717 bp (GRCm38)
  • T to A, chromosome 4 at 126,520,280 bp (GRCm38)
  • T to C, chromosome 4 at 141,469,486 bp (GRCm38)
  • T to C, chromosome 5 at 109,054,038 bp (GRCm38)
  • T to C, chromosome 5 at 124,090,113 bp (GRCm38)
  • T to C, chromosome 5 at 130,669,608 bp (GRCm38)
  • T to C, chromosome 5 at 136,102,601 bp (GRCm38)
  • A to G, chromosome 6 at 52,741,973 bp (GRCm38)
  • G to T, chromosome 6 at 83,032,825 bp (GRCm38)
  • T to A, chromosome 6 at 135,079,166 bp (GRCm38)
  • T to A, chromosome 6 at 137,411,115 bp (GRCm38)
  • A to G, chromosome 7 at 4,770,407 bp (GRCm38)
  • A to G, chromosome 7 at 6,189,691 bp (GRCm38)
  • A to T, chromosome 7 at 18,684,670 bp (GRCm38)
  • A to T, chromosome 7 at 74,359,916 bp (GRCm38)
  • GGTCCCAG to GG, chromosome 7 at 80,098,329 bp (GRCm38)
  • TCCCAGGGCC to TCC, chromosome 7 at 80,098,331 bp (GRCm38)
  • A to T, chromosome 7 at 92,858,400 bp (GRCm38)
  • T to A, chromosome 8 at 4,183,582 bp (GRCm38)
  • T to C, chromosome 8 at 18,714,146 bp (GRCm38)
  • A to G, chromosome 8 at 66,864,546 bp (GRCm38)
  • A to T, chromosome 8 at 83,725,934 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • T to A, chromosome 8 at 117,055,009 bp (GRCm38)
  • A to G, chromosome 9 at 25,301,465 bp (GRCm38)
  • A to G, chromosome 9 at 44,106,376 bp (GRCm38)
  • A to T, chromosome 9 at 56,257,641 bp (GRCm38)
  • T to C, chromosome 9 at 100,947,282 bp (GRCm38)
  • T to A, chromosome 10 at 89,779,876 bp (GRCm38)
  • A to T, chromosome 11 at 20,648,425 bp (GRCm38)
  • A to T, chromosome 11 at 46,577,299 bp (GRCm38)
  • T to A, chromosome 11 at 48,889,671 bp (GRCm38)
  • A to G, chromosome 12 at 52,562,363 bp (GRCm38)
  • C to T, chromosome 12 at 66,568,889 bp (GRCm38)
  • T to C, chromosome 12 at 87,081,827 bp (GRCm38)
  • A to T, chromosome 13 at 22,219,674 bp (GRCm38)
  • T to C, chromosome 13 at 23,934,129 bp (GRCm38)
  • A to T, chromosome 13 at 32,127,052 bp (GRCm38)
  • A to G, chromosome 13 at 67,041,254 bp (GRCm38)
  • T to C, chromosome 13 at 85,221,516 bp (GRCm38)
  • G to T, chromosome 14 at 24,245,308 bp (GRCm38)
  • T to C, chromosome 14 at 50,299,037 bp (GRCm38)
  • T to C, chromosome 14 at 53,616,721 bp (GRCm38)
  • C to A, chromosome 14 at 59,365,384 bp (GRCm38)
  • G to T, chromosome 15 at 16,823,187 bp (GRCm38)
  • GCTTCTTCTTCTTCTTCTT to GCTTCTTCTTCTTCTT, chromosome 15 at 55,016,461 bp (GRCm38)
  • T to C, chromosome 16 at 15,629,336 bp (GRCm38)
  • C to T, chromosome 16 at 91,655,118 bp (GRCm38)
  • C to A, chromosome 17 at 23,291,604 bp (GRCm38)
  • T to C, chromosome 17 at 34,060,873 bp (GRCm38)
  • TGGCGGCGGCGGCGGCGGCGGCGGC to TGGCGGCGGCGGCGGCGGCGGC, chromosome 18 at 36,560,908 bp (GRCm38)
  • A to C, chromosome 18 at 37,820,839 bp (GRCm38)
  • T to C, chromosome 19 at 5,898,565 bp (GRCm38)
  • T to A, chromosome 19 at 13,619,294 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9138 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069012-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.