Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9138Btlr/Mmmh
Stock Number:
069012-MU
Citation ID:
RRID:MMRRC_069012-MU
Other Names:
R9138 (G1)
Major Collection:

Strain Information

Zmpste24
Name: zinc metallopeptidase, STE24
Synonyms: A530043O15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230709
Homologene: 4277
Angpt2
Name: angiopoietin 2
Synonyms: Ang2, Ang-2
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 11601
HGNC: HGNC:485
Homologene: 22401
Chrna4
Name: cholinergic receptor, nicotinic, alpha polypeptide 4
Synonyms: alpha4 nAChR, Acra-4, Acra4, a4 nicotinic receptor, alpha4-nAChR
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 11438
HGNC: HGNC:1958
Homologene: 592
Spen
Name: spen family transcription repressor
Synonyms: Mint
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 56381
Homologene: 124461
Gprc5a
Name: G protein-coupled receptor, family C, group 5, member A
Synonyms: Gprc5a, Raig1, Rai3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 232431
HGNC: HGNC:9836
Homologene: 2961
Kif16b
Name: kinesin family member 16B
Synonyms: N-3 kinesin, 8430434E15Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16558
Homologene: 135708
Septin7
Name: septin 7
Synonyms: Cdc10, Sept7
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235072
VEGA: 9
HGNC: HGNC:1717
Homologene: 1354
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • C to T, chromosome 1 at 26,682,172 bp (GRCm38)
  • C to T, chromosome 1 at 40,543,017 bp (GRCm38)
  • G to T, chromosome 1 at 60,247,745 bp (GRCm38)
  • G to A, chromosome 1 at 67,215,410 bp (GRCm38)
  • T to A, chromosome 1 at 91,110,358 bp (GRCm38)
  • T to C, chromosome 1 at 128,300,157 bp (GRCm38)
  • T to C, chromosome 1 at 139,234,730 bp (GRCm38)
  • T to A, chromosome 2 at 6,023,321 bp (GRCm38)
  • T to C, chromosome 2 at 34,838,908 bp (GRCm38)
  • A to G, chromosome 2 at 36,786,690 bp (GRCm38)
  • T to A, chromosome 2 at 74,675,558 bp (GRCm38)
  • C to A, chromosome 2 at 142,700,556 bp (GRCm38)
  • C to A, chromosome 2 at 148,675,652 bp (GRCm38)
  • T to A, chromosome 2 at 165,395,944 bp (GRCm38)
  • A to G, chromosome 2 at 181,028,982 bp (GRCm38)
  • T to A, chromosome 3 at 103,815,310 bp (GRCm38)
  • A to T, chromosome 4 at 104,731,732 bp (GRCm38)
  • T to G, chromosome 4 at 121,065,821 bp (GRCm38)
  • C to T, chromosome 4 at 124,838,717 bp (GRCm38)
  • T to A, chromosome 4 at 126,520,280 bp (GRCm38)
  • T to C, chromosome 4 at 141,469,486 bp (GRCm38)
  • T to C, chromosome 5 at 109,054,038 bp (GRCm38)
  • T to C, chromosome 5 at 124,090,113 bp (GRCm38)
  • T to C, chromosome 5 at 130,669,608 bp (GRCm38)
  • T to C, chromosome 5 at 136,102,601 bp (GRCm38)
  • A to G, chromosome 6 at 52,741,973 bp (GRCm38)
  • G to T, chromosome 6 at 83,032,825 bp (GRCm38)
  • T to A, chromosome 6 at 135,079,166 bp (GRCm38)
  • T to A, chromosome 6 at 137,411,115 bp (GRCm38)
  • A to G, chromosome 7 at 4,770,407 bp (GRCm38)
  • A to G, chromosome 7 at 6,189,691 bp (GRCm38)
  • A to T, chromosome 7 at 18,684,670 bp (GRCm38)
  • A to T, chromosome 7 at 74,359,916 bp (GRCm38)
  • GGTCCCAG to GG, chromosome 7 at 80,098,329 bp (GRCm38)
  • TCCCAGGGCC to TCC, chromosome 7 at 80,098,331 bp (GRCm38)
  • A to T, chromosome 7 at 92,858,400 bp (GRCm38)
  • T to A, chromosome 8 at 4,183,582 bp (GRCm38)
  • T to C, chromosome 8 at 18,714,146 bp (GRCm38)
  • A to G, chromosome 8 at 66,864,546 bp (GRCm38)
  • A to T, chromosome 8 at 83,725,934 bp (GRCm38)
  • GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA to GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA, chromosome 8 at 109,624,195 bp (GRCm38)
  • T to A, chromosome 8 at 117,055,009 bp (GRCm38)
  • A to G, chromosome 9 at 25,301,465 bp (GRCm38)
  • A to G, chromosome 9 at 44,106,376 bp (GRCm38)
  • A to T, chromosome 9 at 56,257,641 bp (GRCm38)
  • T to C, chromosome 9 at 100,947,282 bp (GRCm38)
  • T to A, chromosome 10 at 89,779,876 bp (GRCm38)
  • A to T, chromosome 11 at 20,648,425 bp (GRCm38)
  • A to T, chromosome 11 at 46,577,299 bp (GRCm38)
  • T to A, chromosome 11 at 48,889,671 bp (GRCm38)
  • A to G, chromosome 12 at 52,562,363 bp (GRCm38)
  • C to T, chromosome 12 at 66,568,889 bp (GRCm38)
  • T to C, chromosome 12 at 87,081,827 bp (GRCm38)
  • A to T, chromosome 13 at 22,219,674 bp (GRCm38)
  • T to C, chromosome 13 at 23,934,129 bp (GRCm38)
  • A to T, chromosome 13 at 32,127,052 bp (GRCm38)
  • A to G, chromosome 13 at 67,041,254 bp (GRCm38)
  • T to C, chromosome 13 at 85,221,516 bp (GRCm38)
  • G to T, chromosome 14 at 24,245,308 bp (GRCm38)
  • T to C, chromosome 14 at 50,299,037 bp (GRCm38)
  • T to C, chromosome 14 at 53,616,721 bp (GRCm38)
  • C to A, chromosome 14 at 59,365,384 bp (GRCm38)
  • G to T, chromosome 15 at 16,823,187 bp (GRCm38)
  • GCTTCTTCTTCTTCTTCTT to GCTTCTTCTTCTTCTT, chromosome 15 at 55,016,461 bp (GRCm38)
  • T to C, chromosome 16 at 15,629,336 bp (GRCm38)
  • C to T, chromosome 16 at 91,655,118 bp (GRCm38)
  • C to A, chromosome 17 at 23,291,604 bp (GRCm38)
  • T to C, chromosome 17 at 34,060,873 bp (GRCm38)
  • TGGCGGCGGCGGCGGCGGCGGCGGC to TGGCGGCGGCGGCGGCGGCGGC, chromosome 18 at 36,560,908 bp (GRCm38)
  • A to C, chromosome 18 at 37,820,839 bp (GRCm38)
  • T to C, chromosome 19 at 5,898,565 bp (GRCm38)
  • T to A, chromosome 19 at 13,619,294 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9138 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069012-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.