Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9146Btlr/Mmmh
Stock Number:
069016-MU
Citation ID:
RRID:MMRRC_069016-MU
Other Names:
R9146 (G1)
Major Collection:

Strain Information

Kit
Name: Kit proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Alg10
Name: ALG10 alpha-1,2-glucosyltransferase
Synonyms: Deaf1, LOC380959, nse5, Alg10b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380959
VEGA: 15
Homologene: 6030
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Pik3r1
Name: phosphoinositide-3-kinase regulatory subunit 1
Synonyms: p85alpha, p50alpha, p55alpha, PI3K
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18708
HGNC: HGNC:8979
Homologene: 7889
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Lrrc2
Name: leucine rich repeat containing 2
Synonyms: 2400002D05Rik, 4933431K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74249
Homologene: 23454
Kdm1a
Name: lysine (K)-specific demethylase 1A
Synonyms: 1810043O07Rik, LSD1, Aof2, Kdm1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 99982
Homologene: 32240
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 38,320,119 bp (GRCm38)
  • A to G, chromosome 1 at 60,518,978 bp (GRCm38)
  • G to T, chromosome 1 at 84,794,160 bp (GRCm38)
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp (GRCm38)
  • A to G, chromosome 1 at 120,054,280 bp (GRCm38)
  • G to A, chromosome 1 at 150,598,390 bp (GRCm38)
  • A to G, chromosome 1 at 179,092,964 bp (GRCm38)
  • T to C, chromosome 2 at 35,034,559 bp (GRCm38)
  • T to C, chromosome 2 at 104,066,708 bp (GRCm38)
  • T to C, chromosome 2 at 127,431,286 bp (GRCm38)
  • T to A, chromosome 2 at 135,340,695 bp (GRCm38)
  • T to A, chromosome 2 at 146,342,332 bp (GRCm38)
  • C to T, chromosome 2 at 146,863,820 bp (GRCm38)
  • C to A, chromosome 2 at 174,645,668 bp (GRCm38)
  • A to G, chromosome 3 at 40,781,669 bp (GRCm38)
  • G to A, chromosome 3 at 45,379,916 bp (GRCm38)
  • T to C, chromosome 3 at 87,095,708 bp (GRCm38)
  • A to G, chromosome 3 at 98,104,538 bp (GRCm38)
  • T to C, chromosome 3 at 146,163,548 bp (GRCm38)
  • G to T, chromosome 4 at 136,602,428 bp (GRCm38)
  • T to A, chromosome 5 at 75,649,645 bp (GRCm38)
  • A to T, chromosome 5 at 110,701,769 bp (GRCm38)
  • T to C, chromosome 5 at 121,349,034 bp (GRCm38)
  • A to G, chromosome 5 at 122,251,682 bp (GRCm38)
  • A to G, chromosome 5 at 130,232,010 bp (GRCm38)
  • G to A, chromosome 5 at 137,290,815 bp (GRCm38)
  • G to T, chromosome 6 at 51,433,192 bp (GRCm38)
  • T to G, chromosome 7 at 11,517,752 bp (GRCm38)
  • C to T, chromosome 7 at 12,632,720 bp (GRCm38)
  • G to C, chromosome 7 at 29,210,487 bp (GRCm38)
  • T to A, chromosome 7 at 48,389,452 bp (GRCm38)
  • C to T, chromosome 7 at 87,001,473 bp (GRCm38)
  • C to A, chromosome 7 at 102,138,830 bp (GRCm38)
  • T to A, chromosome 7 at 104,893,245 bp (GRCm38)
  • T to C, chromosome 7 at 130,467,292 bp (GRCm38)
  • T to A, chromosome 7 at 138,229,859 bp (GRCm38)
  • T to A, chromosome 8 at 15,998,832 bp (GRCm38)
  • G to A, chromosome 8 at 122,500,263 bp (GRCm38)
  • A to G, chromosome 9 at 7,464,997 bp (GRCm38)
  • T to A, chromosome 9 at 44,814,641 bp (GRCm38)
  • C to T, chromosome 9 at 102,542,206 bp (GRCm38)
  • C to T, chromosome 9 at 110,979,514 bp (GRCm38)
  • A to G, chromosome 10 at 100,541,803 bp (GRCm38)
  • T to C, chromosome 10 at 129,487,523 bp (GRCm38)
  • A to G, chromosome 11 at 31,367,847 bp (GRCm38)
  • A to G, chromosome 11 at 53,408,136 bp (GRCm38)
  • G to A, chromosome 11 at 77,437,676 bp (GRCm38)
  • A to T, chromosome 11 at 100,893,666 bp (GRCm38)
  • T to C, chromosome 11 at 119,443,673 bp (GRCm38)
  • T to C, chromosome 13 at 38,023,029 bp (GRCm38)
  • T to A, chromosome 13 at 81,413,172 bp (GRCm38)
  • C to A, chromosome 13 at 101,688,628 bp (GRCm38)
  • A to G, chromosome 15 at 90,228,198 bp (GRCm38)
  • T to A, chromosome 15 at 101,998,935 bp (GRCm38)
  • T to C, chromosome 16 at 96,159,798 bp (GRCm38)
  • A to G, chromosome 17 at 53,462,616 bp (GRCm38)
  • G to A, chromosome 17 at 71,274,336 bp (GRCm38)
  • A to T, chromosome 19 at 39,538,900 bp (GRCm38)
  • C to T, chromosome X at 142,237,751 bp (GRCm38)
  • A to T, chromosome Y at 726,033 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9146 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.

Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain's tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069016-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.