Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9146Btlr/Mmmh
Stock Number:
069016-MU
Citation ID:
RRID:MMRRC_069016-MU
Other Names:
R9146 (G1)
Major Collection:

Strain Information

Kit
Name: KIT proto-oncogene receptor tyrosine kinase
Synonyms: Steel Factor Receptor, c-KIT, Dominant white spotting, belly-spot, Tr-kit, SOW3, SCO5, SCO1, Gsfsow3, Gsfsco5, Gsfsco1, CD117
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16590
HGNC: HGNC:6342
Homologene: 187
Alg10
Name: ALG10 alpha-1,2-glucosyltransferase
Synonyms: Deaf1, LOC380959, nse5, Alg10b
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 380959
VEGA: 15
Homologene: 6030
Notch2
Name: notch 2
Synonyms: Motch B, N2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18129
HGNC: HGNC:7882
Homologene: 7865
Pik3r1
Name: phosphoinositide-3-kinase regulatory subunit 1
Synonyms: p85alpha, p50alpha, p55alpha, PI3K
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 18708
HGNC: HGNC:8979
Homologene: 7889
Ep400
Name: E1A binding protein p400
Synonyms: p400, mDomino, 1700020J09Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 75560
Homologene: 38779
Lrrc2
Name: leucine rich repeat containing 2
Synonyms: 2400002D05Rik, 4933431K03Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 74249
Homologene: 23454
Kdm1a
Name: lysine (K)-specific demethylase 1A
Synonyms: 1810043O07Rik, LSD1, Aof2, Kdm1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 99982
Homologene: 32240
Tmem248
Name: transmembrane protein 248
Synonyms: G430067H08Rik, A930023A16Rik, 0610007L01Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71667
Homologene: 9951
Cep290
Name: centrosomal protein 290
Synonyms: Nphp6, b2b1454Clo, b2b1752Clo, Kiaa
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 216274
VEGA: 10
Homologene: 77213
Smyd3
Name: SET and MYND domain containing 3
Synonyms: Zmynd1, 2410008A19Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 69726
Homologene: 41491
Kmt2a
Name: lysine (K)-specific methyltransferase 2A
Synonyms: trithorax Drosophila, HTRX1, ALL-1, All1, Cxxc7, Mll, Mll1
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 214162
HGNC: HGNC:7132
Homologene: 4338
Stat3
Name: signal transducer and activator of transcription 3
Synonyms: Aprf, 1110034C02Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20848
Homologene: 7960
Trip12
Name: thyroid hormone receptor interactor 12
Synonyms: Gtl6, 1110036I07Rik, 6720416K24Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14897
Homologene: 44226
Aff4
Name: AF4/FMR2 family, member 4
Synonyms: Alf4, Laf4l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 93736
Homologene: 8683
Hjurp
Name: Holliday junction recognition protein
Synonyms: C330011F01Rik, A730008H23Rik, 6430706D22Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 381280
Homologene: 10184
Zfy1
Name: zinc finger protein 1, Y-linked
Synonyms: Zfy-1
Type: Gene
Species: Mouse
Chromosome: Y
NCBI: 22767
Homologene: 56456
Kirrel1
Name: kirre like nephrin family adhesion molecule 1
Synonyms: Neph1, Kirrel1, 6720469N11Rik, Kirrel
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 170643
Homologene: 10089
Raph1
Name: Ras association (RalGDS/AF-6) and pleckstrin homology domains 1
Synonyms: C730009O10Rik, 9430025M21Rik, lamellipodin, Lpd
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77300
Homologene: 71030
Ssh2
Name: slingshot protein phosphatase 2
Synonyms: SSH-2
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237860
Homologene: 14116
Piezo1
Name: piezo-type mechanosensitive ion channel component 1
Synonyms: Piezo1, Fam38a
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 234839
Homologene: 124356
Tctn1
Name: tectonic family member 1
Synonyms: Tect1, G730031O11Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 654470
Homologene: 49770
Hectd4
Name: HECT domain E3 ubiquitin protein ligase 4
Synonyms: Gm15800
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 269700
Homologene: 28297
Csmd1
Name: CUB and Sushi multiple domains 1
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 94109
Homologene: 69536
Hmcn1
Name: hemicentin 1
Synonyms: LOC240793, EG545370
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 545370
Homologene: 23741
Zfp831
Name: zinc finger protein 831
Synonyms: ENSMUSG00000050600, OTTMUSG00000017459
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 100043757
Homologene: 19013
Aff3
Name: AF4/FMR2 family, member 3
Synonyms: LAF-4, 3222402O04Rik, Laf4
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 16764
HGNC: HGNC:6473
Homologene: 1718
Rnf213
Name: ring finger protein 213
Synonyms: D11Ertd759e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 672511
Homologene: 45439
Mcoln2
Name: mucolipin 2
Synonyms: 3300002C04Rik, mucolipidin 2, TRPML2
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 68279
Homologene: 12258
Emilin2
Name: elastin microfibril interfacer 2
Synonyms: basilin, FOAP-10
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 246707
VEGA: 17
Homologene: 36483
Ralgapa2
Name: Ral GTPase activating protein, alpha subunit 2 (catalytic)
Synonyms: A230067G21Rik, RGC2, AS250
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241694
Homologene: 28131
Stc2
Name: stanniocalcin 2
Synonyms: mustc2, Stc2l
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 20856
Homologene: 2753
Adgrv1
Name: adhesion G protein-coupled receptor V1
Synonyms: VLGR1, Mass1, Mgr1, Gpr98
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 110789
Homologene: 19815
Sctr
Name: secretin receptor
Synonyms: 6530402O03Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 319229
Homologene: 68290
Plcb1
Name: phospholipase C, beta 1
Synonyms: 3110043I21Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18795
Homologene: 22876
Hc
Name: hemolytic complement
Synonyms: C5a, C5, He, Hfib2
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 15139
HGNC: HGNC:1331
Homologene: 20412
Pcdh10
Name: protocadherin 10
Synonyms: 6430703F07Rik, 6430521D13Rik, OL-pc, Olpc
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18526
Homologene: 74967
Ache
Name: acetylcholinesterase
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11423
HGNC: HGNC:108
Homologene: 543
Gpat2
Name: glycerol-3-phosphate acyltransferase 2, mitochondrial
Synonyms: Gpat2, A530057A03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 215456
Homologene: 19037
Cyp2c39
Name: cytochrome P450, family 2, subfamily c, polypeptide 39
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 13098
Homologene: 117948
Mmp1a
Name: matrix metallopeptidase 1a (interstitial collagenase)
Synonyms: Mcol-A
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 83995
VEGA: 9
HGNC: HGNC:7155
Homologene: 20544
Vmn2r79
Name: vomeronasal 2, receptor 79
Synonyms: EG621430
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 621430
Homologene: 115466
Gm10912
Name: predicted gene 10912
Type: Gene
Species: Mouse
Chromosome: 2
Vmn2r54
Name: vomeronasal 2, receptor 54
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 666085
Homologene: 104040
Nfe2l3
Name: nuclear factor, erythroid derived 2, like 3
Synonyms: Nrf3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 18025
HGNC: HGNC:7783
Homologene: 3168
Hspa4l
Name: heat shock protein 4 like
Synonyms: APG-1, 94kDa, Osp94
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 18415
Homologene: 22610
Kiz
Name: kizuna centrosomal protein
Synonyms: LOC228730, Ncrna00153, Gm114, Plk1s1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228730
Homologene: 10219
Krt8
Name: keratin 8
Synonyms: K8, EndoA, cytokeratin-8, cytokeratin8, cytokeratin 8, Krt-2.8, Card2, Krt2-8, TROMA-1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 16691
VEGA: 15
HGNC: HGNC:6446
Homologene: 55643
Catsperg1
Name: cation channel sperm associated auxiliary subunit gamma 1
Synonyms: A230107C01Rik, Catsperg
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 320225
Homologene: 10915
Or52n2
Name: olfactory receptor family 52 subfamily N member 2
Synonyms: GA_x6K02T2PBJ9-7522449-7521493, MOR34-1, Olfr666
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 259100
Homologene: 64956
Tcerg1l
Name: transcription elongation regulator 1-like
Synonyms: 5730476P14Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 70571
Homologene: 52165
Ky
Name: kyphoscoliosis peptidase
Synonyms: D9Mgc44e
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 16716
Homologene: 11506
Lca5l
Name: Leber congenital amaurosis 5-like
Synonyms: 4921526F01Rik
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 385668
HGNC: HGNC:1255
Homologene: 47978
Cage1
Name: cancer antigen 1
Synonyms: CAGE1, 4933427I01Rik, Ctag3
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 71213
Homologene: 18484
Efhb
Name: EF hand domain family, member B
Synonyms: 4921525D22Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211482
VEGA: 17
Homologene: 16982
Mrgprb8
Name: MAS-related GPR, member B8
Synonyms: MrgB8
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 404240
Homologene: 83620
Or6c7
Name: olfactory receptor family 6 subfamily C member 7
Synonyms: GA_x6K02T2PULF-11165842-11166815, MOR111-9P, MOR111-13, Olfr789-ps1, Olfr789
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 258148
Zscan4-ps2
Name: zinc finger and SCAN domain containing 4, pseudogene 2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 665913
Nxt2
Name: nuclear transport factor 2-like export factor 2
Synonyms: P15-2, 6330587F24Rik
Type: Gene
Species: Mouse
Chromosome: X
NCBI: 237082
Homologene: 10273
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 38,320,119 bp (GRCm38)
  • A to G, chromosome 1 at 60,518,978 bp (GRCm38)
  • G to T, chromosome 1 at 84,794,160 bp (GRCm38)
  • TCTGGGAGGGCTTGCTCCGGGGGCAGTGTGTCCTGTTCTTGTGCAGCCCCTGCT to TCT, chromosome 1 at 88,266,278 bp (GRCm38)
  • A to G, chromosome 1 at 120,054,280 bp (GRCm38)
  • G to A, chromosome 1 at 150,598,390 bp (GRCm38)
  • A to G, chromosome 1 at 179,092,964 bp (GRCm38)
  • T to C, chromosome 2 at 35,034,559 bp (GRCm38)
  • T to C, chromosome 2 at 104,066,708 bp (GRCm38)
  • T to C, chromosome 2 at 127,431,286 bp (GRCm38)
  • T to A, chromosome 2 at 135,340,695 bp (GRCm38)
  • T to A, chromosome 2 at 146,342,332 bp (GRCm38)
  • C to T, chromosome 2 at 146,863,820 bp (GRCm38)
  • C to A, chromosome 2 at 174,645,668 bp (GRCm38)
  • A to G, chromosome 3 at 40,781,669 bp (GRCm38)
  • G to A, chromosome 3 at 45,379,916 bp (GRCm38)
  • T to C, chromosome 3 at 87,095,708 bp (GRCm38)
  • A to G, chromosome 3 at 98,104,538 bp (GRCm38)
  • T to C, chromosome 3 at 146,163,548 bp (GRCm38)
  • G to T, chromosome 4 at 136,602,428 bp (GRCm38)
  • T to A, chromosome 5 at 75,649,645 bp (GRCm38)
  • A to T, chromosome 5 at 110,701,769 bp (GRCm38)
  • T to C, chromosome 5 at 121,349,034 bp (GRCm38)
  • A to G, chromosome 5 at 122,251,682 bp (GRCm38)
  • A to G, chromosome 5 at 130,232,010 bp (GRCm38)
  • G to A, chromosome 5 at 137,290,815 bp (GRCm38)
  • G to T, chromosome 6 at 51,433,192 bp (GRCm38)
  • T to G, chromosome 7 at 11,517,752 bp (GRCm38)
  • C to T, chromosome 7 at 12,632,720 bp (GRCm38)
  • G to C, chromosome 7 at 29,210,487 bp (GRCm38)
  • T to A, chromosome 7 at 48,389,452 bp (GRCm38)
  • C to T, chromosome 7 at 87,001,473 bp (GRCm38)
  • C to A, chromosome 7 at 102,138,830 bp (GRCm38)
  • T to A, chromosome 7 at 104,893,245 bp (GRCm38)
  • T to C, chromosome 7 at 130,467,292 bp (GRCm38)
  • T to A, chromosome 7 at 138,229,859 bp (GRCm38)
  • T to A, chromosome 8 at 15,998,832 bp (GRCm38)
  • G to A, chromosome 8 at 122,500,263 bp (GRCm38)
  • A to G, chromosome 9 at 7,464,997 bp (GRCm38)
  • T to A, chromosome 9 at 44,814,641 bp (GRCm38)
  • C to T, chromosome 9 at 102,542,206 bp (GRCm38)
  • C to T, chromosome 9 at 110,979,514 bp (GRCm38)
  • A to G, chromosome 10 at 100,541,803 bp (GRCm38)
  • T to C, chromosome 10 at 129,487,523 bp (GRCm38)
  • A to G, chromosome 11 at 31,367,847 bp (GRCm38)
  • A to G, chromosome 11 at 53,408,136 bp (GRCm38)
  • G to A, chromosome 11 at 77,437,676 bp (GRCm38)
  • A to T, chromosome 11 at 100,893,666 bp (GRCm38)
  • T to C, chromosome 11 at 119,443,673 bp (GRCm38)
  • T to C, chromosome 13 at 38,023,029 bp (GRCm38)
  • T to A, chromosome 13 at 81,413,172 bp (GRCm38)
  • C to A, chromosome 13 at 101,688,628 bp (GRCm38)
  • A to G, chromosome 15 at 90,228,198 bp (GRCm38)
  • T to A, chromosome 15 at 101,998,935 bp (GRCm38)
  • T to C, chromosome 16 at 96,159,798 bp (GRCm38)
  • A to G, chromosome 17 at 53,462,616 bp (GRCm38)
  • G to A, chromosome 17 at 71,274,336 bp (GRCm38)
  • A to T, chromosome 19 at 39,538,900 bp (GRCm38)
  • C to T, chromosome X at 142,237,751 bp (GRCm38)
  • A to T, chromosome Y at 726,033 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9146 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069016-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.