Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9168Btlr/Mmmh
Stock Number:
069024-MU
Citation ID:
RRID:MMRRC_069024-MU
Other Names:
R9168 (G1)
Major Collection:

Strain Information

Rest
Name: RE1-silencing transcription factor
Synonyms: 2610008J04Rik, NRSF
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 19712
HGNC: HGNC:9966
Homologene: 4099
Lhx5
Name: LIM homeobox protein 5
Synonyms: Lim2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 16873
Homologene: 40621
Ascl1
Name: achaete-scute family bHLH transcription factor 1
Synonyms: ASH1, Mash1, bHLHa46
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 17172
HGNC: HGNC:738
Homologene: 31234
En1
Name: engrailed 1
Synonyms: Mo-en.1, En-1, engrailed-1
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 13798
HGNC: HGNC:3342
Homologene: 50663
Mbtps1
Name: membrane-bound transcription factor peptidase, site 1
Synonyms: subtilisin/kexin isozyme-1, SKI-1, S1P, 0610038M03Rik, site-1 protease
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 56453
Homologene: 2808
Phf20
Name: PHD finger protein 20
Synonyms: 6820402O20Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228829
Homologene: 9507
Rrp12
Name: ribosomal RNA processing 12 homolog
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 107094
VEGA: 19
Homologene: 22370
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to A, chromosome 1 at 60,291,888 bp (GRCm38)
  • T to C, chromosome 1 at 87,087,328 bp (GRCm38)
  • C to T, chromosome 1 at 90,138,215 bp (GRCm38)
  • A to G, chromosome 1 at 120,603,163 bp (GRCm38)
  • T to A, chromosome 1 at 132,489,726 bp (GRCm38)
  • A to C, chromosome 1 at 180,332,463 bp (GRCm38)
  • A to G, chromosome 2 at 52,195,684 bp (GRCm38)
  • C to T, chromosome 2 at 76,848,916 bp (GRCm38)
  • T to C, chromosome 2 at 90,464,572 bp (GRCm38)
  • C to T, chromosome 2 at 156,267,314 bp (GRCm38)
  • T to A, chromosome 3 at 30,907,395 bp (GRCm38)
  • T to G, chromosome 3 at 82,102,046 bp (GRCm38)
  • T to G, chromosome 3 at 87,726,483 bp (GRCm38)
  • C to A, chromosome 3 at 157,567,787 bp (GRCm38)
  • C to G, chromosome 4 at 21,679,659 bp (GRCm38)
  • C to A, chromosome 4 at 33,045,111 bp (GRCm38)
  • T to C, chromosome 4 at 42,793,380 bp (GRCm38)
  • T to A, chromosome 4 at 57,910,113 bp (GRCm38)
  • A to T, chromosome 4 at 99,065,406 bp (GRCm38)
  • A to T, chromosome 4 at 149,107,769 bp (GRCm38)
  • G to T, chromosome 5 at 15,472,134 bp (GRCm38)
  • C to T, chromosome 5 at 33,433,787 bp (GRCm38)
  • GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC to GGGGGCCTGCCCCTCCCACGGGGCCTGCCCCTCCCACGGAGCCTGCCCCTCCCACGGGGC, chromosome 5 at 77,281,804 bp (GRCm38)
  • T to A, chromosome 5 at 95,270,274 bp (GRCm38)
  • A to G, chromosome 5 at 120,432,345 bp (GRCm38)
  • T to C, chromosome 5 at 121,467,912 bp (GRCm38)
  • A to T, chromosome 6 at 50,352,782 bp (GRCm38)
  • T to C, chromosome 6 at 121,325,083 bp (GRCm38)
  • T to C, chromosome 6 at 129,639,179 bp (GRCm38)
  • T to G, chromosome 7 at 28,790,659 bp (GRCm38)
  • A to T, chromosome 7 at 42,613,587 bp (GRCm38)
  • G to A, chromosome 7 at 56,152,460 bp (GRCm38)
  • A to G, chromosome 7 at 104,959,794 bp (GRCm38)
  • T to C, chromosome 7 at 109,329,540 bp (GRCm38)
  • G to T, chromosome 8 at 34,165,189 bp (GRCm38)
  • T to A, chromosome 8 at 105,149,418 bp (GRCm38)
  • C to T, chromosome 8 at 105,272,741 bp (GRCm38)
  • A to G, chromosome 8 at 119,521,863 bp (GRCm38)
  • T to C, chromosome 9 at 20,027,522 bp (GRCm38)
  • C to A, chromosome 9 at 55,544,943 bp (GRCm38)
  • A to C, chromosome 9 at 79,641,501 bp (GRCm38)
  • C to A, chromosome 9 at 94,712,947 bp (GRCm38)
  • T to C, chromosome 9 at 110,727,136 bp (GRCm38)
  • C to A, chromosome 10 at 28,782,237 bp (GRCm38)
  • T to C, chromosome 10 at 81,514,358 bp (GRCm38)
  • T to C, chromosome 10 at 87,492,499 bp (GRCm38)
  • GGGCGGCGGCGGCGGCG to GGGCGGCGGCGGCG, chromosome 10 at 127,059,491 bp (GRCm38)
  • C to T, chromosome 11 at 36,039,895 bp (GRCm38)
  • A to T, chromosome 11 at 100,383,393 bp (GRCm38)
  • T to C, chromosome 11 at 101,195,607 bp (GRCm38)
  • G to A, chromosome 11 at 115,475,898 bp (GRCm38)
  • T to C, chromosome 12 at 91,267,020 bp (GRCm38)
  • T to G, chromosome 12 at 111,320,083 bp (GRCm38)
  • T to A, chromosome 12 at 111,444,948 bp (GRCm38)
  • T to A, chromosome 12 at 113,415,583 bp (GRCm38)
  • A to G, chromosome 13 at 55,322,197 bp (GRCm38)
  • C to A, chromosome 13 at 67,593,823 bp (GRCm38)
  • C to T, chromosome 14 at 66,187,450 bp (GRCm38)
  • T to C, chromosome 14 at 79,453,113 bp (GRCm38)
  • T to A, chromosome 16 at 17,784,204 bp (GRCm38)
  • C to T, chromosome 16 at 65,520,541 bp (GRCm38)
  • A to G, chromosome 16 at 96,619,568 bp (GRCm38)
  • T to A, chromosome 17 at 19,588,876 bp (GRCm38)
  • T to C, chromosome 17 at 25,878,171 bp (GRCm38)
  • G to T, chromosome 17 at 26,095,415 bp (GRCm38)
  • T to C, chromosome 17 at 37,660,156 bp (GRCm38)
  • T to A, chromosome 17 at 44,102,250 bp (GRCm38)
  • A to C, chromosome 17 at 46,752,093 bp (GRCm38)
  • T to C, chromosome 19 at 34,474,505 bp (GRCm38)
  • C to T, chromosome 19 at 39,767,375 bp (GRCm38)
  • A to G, chromosome 19 at 41,877,164 bp (GRCm38)
  • C to A, chromosome 19 at 46,320,794 bp (GRCm38)
  • T to C, chromosome 19 at 57,464,427 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Submitter
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9168 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The submitter or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069024-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.