Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9233Btlr/Mmmh
Stock Number:
069063-MU
Citation ID:
RRID:MMRRC_069063-MU
Other Names:
R9233 (G1)
Major Collection:

Strain Information

Lias
Name: lipoic acid synthetase
Synonyms: MGC7254, mLip1, 4933425M12Rik, 2900022L22Rik, 7a5ex
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 79464
Homologene: 4997
Spred1
Name: sprouty protein with EVH-1 domain 1, related sequence
Synonyms: Spred-1, 5730461F13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 114715
Homologene: 24919
Etv4
Name: ets variant 4
Synonyms: Pea-3, Pea3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18612
HGNC: HGNC:3493
Homologene: 1504
Gmps
Name: guanine monophosphate synthetase
Synonyms: Gm9479
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229363
HGNC: HGNC:4378
Homologene: 68367
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Zmym4
Name: zinc finger, MYM-type 4
Synonyms: 6330503C17Rik, Zfp262
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67785
Homologene: 35470
Anp32b
Name: acidic nuclear phosphoprotein 32 family member B
Synonyms: PHAPI2a, PAL31, 2410015B15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67628
Homologene: 137872
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 74,571,129 bp (GRCm38)
  • T to A, chromosome 1 at 164,219,451 bp (GRCm38)
  • C to T, chromosome 1 at 167,308,563 bp (GRCm38)
  • T to C, chromosome 1 at 183,400,724 bp (GRCm38)
  • A to G, chromosome 2 at 25,406,317 bp (GRCm38)
  • A to C, chromosome 2 at 30,954,003 bp (GRCm38)
  • G to A, chromosome 2 at 117,172,163 bp (GRCm38)
  • T to C, chromosome 2 at 131,134,116 bp (GRCm38)
  • C to T, chromosome 2 at 155,336,690 bp (GRCm38)
  • A to T, chromosome 2 at 180,198,709 bp (GRCm38)
  • C to T, chromosome 3 at 64,016,712 bp (GRCm38)
  • T to A, chromosome 3 at 138,116,519 bp (GRCm38)
  • A to T, chromosome 4 at 46,463,909 bp (GRCm38)
  • A to G, chromosome 4 at 118,146,996 bp (GRCm38)
  • G to A, chromosome 4 at 119,422,200 bp (GRCm38)
  • A to G, chromosome 4 at 126,882,517 bp (GRCm38)
  • G to A, chromosome 4 at 145,152,774 bp (GRCm38)
  • G to A, chromosome 5 at 24,413,839 bp (GRCm38)
  • A to G, chromosome 5 at 28,339,241 bp (GRCm38)
  • G to T, chromosome 5 at 65,143,330 bp (GRCm38)
  • A to G, chromosome 5 at 65,393,988 bp (GRCm38)
  • G to A, chromosome 5 at 87,465,413 bp (GRCm38)
  • G to A, chromosome 5 at 112,378,039 bp (GRCm38)
  • C to T, chromosome 5 at 138,178,391 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • A to G, chromosome 6 at 28,418,711 bp (GRCm38)
  • A to T, chromosome 6 at 32,803,910 bp (GRCm38)
  • A to G, chromosome 6 at 39,805,513 bp (GRCm38)
  • A to G, chromosome 6 at 124,859,051 bp (GRCm38)
  • G to A, chromosome 7 at 13,029,563 bp (GRCm38)
  • T to C, chromosome 7 at 22,761,956 bp (GRCm38)
  • A to G, chromosome 7 at 28,140,094 bp (GRCm38)
  • A to G, chromosome 7 at 34,099,759 bp (GRCm38)
  • T to G, chromosome 7 at 81,343,749 bp (GRCm38)
  • T to G, chromosome 7 at 99,867,367 bp (GRCm38)
  • T to G, chromosome 7 at 112,382,192 bp (GRCm38)
  • C to T, chromosome 8 at 84,544,654 bp (GRCm38)
  • T to C, chromosome 9 at 51,145,087 bp (GRCm38)
  • T to A, chromosome 9 at 100,929,971 bp (GRCm38)
  • A to G, chromosome 9 at 107,930,701 bp (GRCm38)
  • A to G, chromosome 9 at 108,117,090 bp (GRCm38)
  • T to C, chromosome 10 at 81,178,834 bp (GRCm38)
  • A to G, chromosome 11 at 69,884,658 bp (GRCm38)
  • A to G, chromosome 11 at 75,525,894 bp (GRCm38)
  • A to G, chromosome 11 at 76,213,116 bp (GRCm38)
  • G to A, chromosome 11 at 77,046,210 bp (GRCm38)
  • A to C, chromosome 11 at 83,003,596 bp (GRCm38)
  • A to C, chromosome 11 at 101,771,706 bp (GRCm38)
  • G to A, chromosome 11 at 106,284,192 bp (GRCm38)
  • G to T, chromosome 11 at 110,191,670 bp (GRCm38)
  • A to G, chromosome 12 at 11,309,290 bp (GRCm38)
  • T to A, chromosome 12 at 28,722,415 bp (GRCm38)
  • A to G, chromosome 12 at 72,556,813 bp (GRCm38)
  • A to T, chromosome 13 at 11,595,886 bp (GRCm38)
  • A to G, chromosome 13 at 22,088,229 bp (GRCm38)
  • T to C, chromosome 13 at 53,111,554 bp (GRCm38)
  • A to T, chromosome 13 at 62,841,808 bp (GRCm38)
  • G to T, chromosome 13 at 67,670,898 bp (GRCm38)
  • A to T, chromosome 13 at 113,366,220 bp (GRCm38)
  • T to C, chromosome 14 at 118,887,223 bp (GRCm38)
  • T to A, chromosome 14 at 121,583,369 bp (GRCm38)
  • C to T, chromosome 15 at 82,089,551 bp (GRCm38)
  • T to C, chromosome 15 at 89,099,841 bp (GRCm38)
  • A to T, chromosome 16 at 36,033,423 bp (GRCm38)
  • A to G, chromosome 16 at 94,666,054 bp (GRCm38)
  • A to T, chromosome 17 at 34,603,352 bp (GRCm38)
  • A to C, chromosome 17 at 52,978,140 bp (GRCm38)
  • T to A, chromosome 17 at 87,746,110 bp (GRCm38)
  • G to T, chromosome 19 at 3,902,543 bp (GRCm38)
  • T to A, chromosome 19 at 57,380,666 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain GQC Summary
Gene Specific Genotyping:

To request gene-specific and other genotyping services for a strain, please contact the distribution MMRRC Center for more information.

Background Genetic Quality:

The MMRRC has developed a Genetic Quality Control pipeline using the MiniMUGA array to provide additional information to identify and validate genetic backgrounds of MMRRC strains. For more information on whether genetic background data is available, please contact MMRRC_GeneticQC@med.unc.edu. Note: that MiniMUGA genetic background data is not available on all strains, but can be ordered if desired.

Suggested Control Mice
Littermates of all relevant genotypes.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9233 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.


Disclaimer: If MMRRC Strain Genetic Quality Control (GQC; based on MiniMUGA genotyping and analysis) has been completed for this strain, the information might differ from the genetic background information provided by the submitter. MiniMUGA genetic analysis is done on a strain’s tissue samples taken when archived by or ordered from the assigned MMRRC Center.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069063-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.