Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9233Btlr/Mmmh
Stock Number:
069063-MU
Citation ID:
RRID:MMRRC_069063-MU
Other Names:
R9233 (G1)
Major Collection:

Strain Information

Lias
Name: lipoic acid synthetase
Synonyms: MGC7254, mLip1, 4933425M12Rik, 2900022L22Rik, 7a5ex
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 79464
Homologene: 4997
Spred1
Name: sprouty protein with EVH-1 domain 1, related sequence
Synonyms: Spred-1, 5730461F13Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 114715
Homologene: 24919
Etv4
Name: ets variant 4
Synonyms: Pea-3, Pea3
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 18612
HGNC: HGNC:3493
Homologene: 1504
Gmps
Name: guanine monophosphate synthetase
Synonyms: Gm9479
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 229363
HGNC: HGNC:4378
Homologene: 68367
Dock9
Name: dedicator of cytokinesis 9
Synonyms: B230309H04Rik, D14Wsu89e, Zizimin1
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 105445
Homologene: 41026
Zmym4
Name: zinc finger, MYM-type 4
Synonyms: 6330503C17Rik, Zfp262
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67785
Homologene: 35470
Anp32b
Name: acidic nuclear phosphoprotein 32 family member B
Synonyms: PHAPI2a, PAL31, 2410015B15Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 67628
Homologene: 137872
Nsrp1
Name: nuclear speckle regulatory protein 1
Synonyms: NSpr70, Ccdc55
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 237859
Homologene: 134095
Trappc12
Name: trafficking protein particle complex 12
Synonyms: CGI-87, D930014A20Rik, Ttc15
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217449
VEGA: 12
Homologene: 34805
Kpna1
Name: karyopherin subunit alpha 1
Synonyms: mSRP1, m-importin-alpha-S1, Rch2, NPI1, importin alpha 5
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 16646
HGNC: HGNC:6394
Homologene: 55642
Dyrk1a
Name: dual-specificity tyrosine phosphorylation regulated kinase 1a
Synonyms: Mnbh, Dyrk, D16Ertd493e, 2310043O08Rik, D16Ertd272e
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 13548
HGNC: HGNC:3091
Homologene: 55576
Stag1
Name: STAG1 cohesin complex component
Synonyms: SA-1, Scc3
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 20842
Homologene: 21191
Chchd3
Name: coiled-coil-helix-coiled-coil-helix domain containing 3
Synonyms: 1700039J09Rik, 0610041L09Rik, Micos19
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 66075
Homologene: 9851
Eef2
Name: eukaryotic translation elongation factor 2
Synonyms: Ef-2
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 13629
VEGA: 10
HGNC: HGNC:3214
Homologene: 134867
Ryr2
Name: ryanodine receptor 2, cardiac
Synonyms: 9330127I20Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 20191
VEGA: 13
Homologene: 37423
Ap4m1
Name: adaptor-related protein complex AP-4, mu 1
Synonyms: 4930443L05Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 11781
HGNC: HGNC:574
Homologene: 3467
Tor1b
Name: torsin family 1, member B
Synonyms: DQ1, 2610016F05Rik, torsinB
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 30934
Homologene: 56677
Lama5
Name: laminin, alpha 5
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 16776
HGNC: HGNC:6485
Homologene: 4060
Vps13d
Name: vacuolar protein sorting 13D
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230895
Homologene: 15583
Smc6
Name: structural maintenance of chromosomes 6
Synonyms: 2810489L22Rik, 3830418C19Rik, Smc6l1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67241
VEGA: 12
Homologene: 41575
Zfp738
Name: zinc finger protein 738
Synonyms: 6720487G11Rik, 3830402I07Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408068
Homologene: 133713
Rps17
Name: ribosomal protein S17
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20068
Homologene: 110867
Mei1
Name: meiotic double-stranded break formation protein 1
Synonyms: mei1
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 74369
Homologene: 46535
Rbm33
Name: RNA binding motif protein 33
Synonyms: 6430512A10Rik, 3200001K10Rik, Prr8
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 381626
Homologene: 137386
Tmco1
Name: transmembrane and coiled-coil domains 1
Synonyms: ESTM39, 1190006A08Rik, 4930403O06Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 68944
Homologene: 10384
Zfp142
Name: zinc finger protein 142
Synonyms: 9330177B18Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 77264
Homologene: 3723
Kdm4a
Name: lysine (K)-specific demethylase 4A
Synonyms: Jmjd2, D4Ertd222e, JHDM3A, Jmjd2a
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 230674
Homologene: 27780
Gemin4
Name: gem nuclear organelle associated protein 4
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 276919
Homologene: 69193
Peg10
Name: paternally expressed 10
Synonyms: MEF3L, HB-1, MyEF-3, MyEF-3 like, Edr, Mart2, Mar2, Rtl2
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 170676
Homologene: 116067
Hspa12b
Name: heat shock protein 12B
Synonyms: 2700081N06Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 72630
Homologene: 41749
Cacna1a
Name: calcium channel, voltage-dependent, P/Q type, alpha 1A subunit
Synonyms: Cacnl1a4, alpha1A, Ccha1a, SCA6, nmf352, smrl
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 12286
HGNC: HGNC:1388
Homologene: 56383
Cspg4b
Name: chondroitin sulfate proteoglycan 4B
Synonyms: BC067074
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 408066
Mttp
Name: microsomal triglyceride transfer protein
Synonyms: MTP, 1810043K16Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 17777
HGNC: HGNC:7467
Homologene: 212
Fhip2a
Name: FHF complex subunit HOOK interacting protein 2A
Synonyms: Fam160b1
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 226252
VEGA: 19
Homologene: 28133
F5
Name: coagulation factor V
Synonyms: Cf-5, Cf5
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 14067
HGNC: HGNC:3542
Homologene: 104
Pcnx4
Name: pecanex homolog 4
Synonyms: 1810048J11Rik, Pcnxl4
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 67708
VEGA: 12
Homologene: 23366
Asic3
Name: acid-sensing ion channel 3
Synonyms: DRASIC, Accn3
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 171209
HGNC: HGNC:101
Homologene: 20999
Fbp2
Name: fructose bisphosphatase 2
Synonyms: FBPase muscle, Fbp-1
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 14120
VEGA: 13
HGNC: HGNC:3607
Homologene: 55784
Fcgbpl1
Name: Fc fragment of IgG binding protein like 1
Synonyms: 9530053A07Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 319482
Homologene: 130055
Gcc1
Name: golgi coiled coil 1
Synonyms: 4932417P04Rik
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 74375
Homologene: 11567
Klhl5
Name: kelch-like 5
Synonyms: 1300013C10Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 71778
HGNC: HGNC:6356
Homologene: 56736
Bsn
Name: bassoon
Synonyms: presynaptic cytomatrix protein
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 12217
HGNC: HGNC:1117
Homologene: 31161
Abca6
Name: ATP-binding cassette, sub-family A member 6
Synonyms: 6330565N06Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 76184
HGNC: HGNC:36
Homologene: 71264
Ror2
Name: receptor tyrosine kinase-like orphan receptor 2
Synonyms: Ntrkr2
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 26564
Homologene: 55831
Scarf1
Name: scavenger receptor class F, member 1
Synonyms: SREC, SREC-I
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 380713
Homologene: 2741
Micalcl
Name: MICAL C-terminal like
Synonyms: 4921517J23Rik, Ebitein1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100504195
Homologene: 13149
Trim28
Name: tripartite motif-containing 28
Synonyms: KRIP-1, KAP-1, Tif1b, MommeD9
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 21849
Homologene: 21175
Acap1
Name: ArfGAP with coiled-coil, ankyrin repeat and PH domains 1
Synonyms: Centb1
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 216859
Homologene: 22835
Actl11
Name: actin-like 11
Synonyms: 4921517D21Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 67722
Homologene: 69412
Tcam1
Name: testicular cell adhesion molecule 1
Synonyms: 4930570F09Rik
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 75870
Homologene: 123944
Kcnh8
Name: potassium voltage-gated channel, subfamily H (eag-related), member 8
Synonyms: Kv12.1, ELK1, C130090D05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 211468
Homologene: 14332
Dzip1
Name: DAZ interacting protein 1
Synonyms: 2510025K24Rik, 2810422M04Rik
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 66573
VEGA: 14
Homologene: 45708
Xrra1
Name: X-ray radiation resistance associated 1
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 446101
Homologene: 19547
Mrps33
Name: mitochondrial ribosomal protein S33
Synonyms: MRP-S33, CGI-139, PTD003, Gdap3
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14548
Homologene: 7729
Npdc1
Name: neural proliferation, differentiation and control 1
Synonyms: NPDC-1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 18146
HGNC: HGNC:7899
Homologene: 32050
Selenoo
Name: selenoprotein O
Synonyms: 1300018J18Rik, Selo
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 223776
Homologene: 69439
Tcirg1
Name: T cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
Synonyms: V-ATPase a3, OC-116, TIRC7, ATP6a3, Atp6i
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 27060
Homologene: 4392
Ppcs
Name: phosphopantothenoylcysteine synthetase
Synonyms: 6330579B17Rik
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 106564
Homologene: 6173
Gpr162
Name: G protein-coupled receptor 162
Synonyms: A-2, Grca
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 14788
Homologene: 8400
Kcnk12
Name: potassium channel, subfamily K, member 12
Synonyms: mntk1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 210741
VEGA: 17
HGNC: HGNC:6274
Homologene: 11107
Vmn1r188
Name: vomeronasal 1 receptor 188
Synonyms: V1rh17
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 252912
Homologene: 110880
Pigu
Name: phosphatidylinositol glycan anchor biosynthesis, class U
Synonyms: 5430426F17Rik, Cdc91l1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 228812
Homologene: 6553
Hps4
Name: HPS4, biogenesis of lysosomal organelles complex 3 subunit 2
Synonyms: C130020P05Rik, BLOC-3, 2010205O06Rik, Hermansky-Pudlak syndrome 4
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 192232
Homologene: 11123
Scgb1b30
Name: secretoglobin, family 1B, member 30
Synonyms: Gm12776, Abpa30
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 100043868
Homologene: 114479
Rnf5
Name: ring finger protein 5
Synonyms: 2410131O05Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 54197
Homologene: 56004
Taf1a
Name: TATA-box binding protein associated factor, RNA polymerase I, A
Synonyms: mTAFI48
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 21339
Homologene: 4155
Ugt2a2
Name: UDP glucuronosyltransferase 2 family, polypeptide A2
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 552899
Homologene: 115736
Vmn1r157
Name: vomeronasal 1 receptor 157
Synonyms: Gm4517, Gm8699, Vmn1r109
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 667551
Homologene: 104166
Gm32742
Name: predicted gene, 32742
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 102635385
Homologene: 132734
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • T to C, chromosome 1 at 74,571,129 bp (GRCm38)
  • T to A, chromosome 1 at 164,219,451 bp (GRCm38)
  • C to T, chromosome 1 at 167,308,563 bp (GRCm38)
  • T to C, chromosome 1 at 183,400,724 bp (GRCm38)
  • A to G, chromosome 2 at 25,406,317 bp (GRCm38)
  • A to C, chromosome 2 at 30,954,003 bp (GRCm38)
  • G to A, chromosome 2 at 117,172,163 bp (GRCm38)
  • T to C, chromosome 2 at 131,134,116 bp (GRCm38)
  • C to T, chromosome 2 at 155,336,690 bp (GRCm38)
  • A to T, chromosome 2 at 180,198,709 bp (GRCm38)
  • C to T, chromosome 3 at 64,016,712 bp (GRCm38)
  • T to A, chromosome 3 at 138,116,519 bp (GRCm38)
  • A to T, chromosome 4 at 46,463,909 bp (GRCm38)
  • A to G, chromosome 4 at 118,146,996 bp (GRCm38)
  • G to A, chromosome 4 at 119,422,200 bp (GRCm38)
  • A to G, chromosome 4 at 126,882,517 bp (GRCm38)
  • G to A, chromosome 4 at 145,152,774 bp (GRCm38)
  • G to A, chromosome 5 at 24,413,839 bp (GRCm38)
  • A to G, chromosome 5 at 28,339,241 bp (GRCm38)
  • G to T, chromosome 5 at 65,143,330 bp (GRCm38)
  • A to G, chromosome 5 at 65,393,988 bp (GRCm38)
  • G to A, chromosome 5 at 87,465,413 bp (GRCm38)
  • G to A, chromosome 5 at 112,378,039 bp (GRCm38)
  • C to T, chromosome 5 at 138,178,391 bp (GRCm38)
  • CCACATCAGGATCCACATCAGGATGCACATCAGCATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAG to CCACATCAGGATCCACATCAGGATGCACATCAG, chromosome 6 at 4,756,398 bp (GRCm38)
  • A to G, chromosome 6 at 28,418,711 bp (GRCm38)
  • A to T, chromosome 6 at 32,803,910 bp (GRCm38)
  • A to G, chromosome 6 at 39,805,513 bp (GRCm38)
  • A to G, chromosome 6 at 124,859,051 bp (GRCm38)
  • G to A, chromosome 7 at 13,029,563 bp (GRCm38)
  • T to C, chromosome 7 at 22,761,956 bp (GRCm38)
  • A to G, chromosome 7 at 28,140,094 bp (GRCm38)
  • A to G, chromosome 7 at 34,099,759 bp (GRCm38)
  • T to G, chromosome 7 at 81,343,749 bp (GRCm38)
  • T to G, chromosome 7 at 99,867,367 bp (GRCm38)
  • T to G, chromosome 7 at 112,382,192 bp (GRCm38)
  • C to T, chromosome 8 at 84,544,654 bp (GRCm38)
  • T to C, chromosome 9 at 51,145,087 bp (GRCm38)
  • T to A, chromosome 9 at 100,929,971 bp (GRCm38)
  • A to G, chromosome 9 at 107,930,701 bp (GRCm38)
  • A to G, chromosome 9 at 108,117,090 bp (GRCm38)
  • T to C, chromosome 10 at 81,178,834 bp (GRCm38)
  • A to G, chromosome 11 at 69,884,658 bp (GRCm38)
  • A to G, chromosome 11 at 75,525,894 bp (GRCm38)
  • A to G, chromosome 11 at 76,213,116 bp (GRCm38)
  • G to A, chromosome 11 at 77,046,210 bp (GRCm38)
  • A to C, chromosome 11 at 83,003,596 bp (GRCm38)
  • A to C, chromosome 11 at 101,771,706 bp (GRCm38)
  • G to A, chromosome 11 at 106,284,192 bp (GRCm38)
  • G to T, chromosome 11 at 110,191,670 bp (GRCm38)
  • A to G, chromosome 12 at 11,309,290 bp (GRCm38)
  • T to A, chromosome 12 at 28,722,415 bp (GRCm38)
  • A to G, chromosome 12 at 72,556,813 bp (GRCm38)
  • A to T, chromosome 13 at 11,595,886 bp (GRCm38)
  • A to G, chromosome 13 at 22,088,229 bp (GRCm38)
  • T to C, chromosome 13 at 53,111,554 bp (GRCm38)
  • A to T, chromosome 13 at 62,841,808 bp (GRCm38)
  • G to T, chromosome 13 at 67,670,898 bp (GRCm38)
  • A to T, chromosome 13 at 113,366,220 bp (GRCm38)
  • T to C, chromosome 14 at 118,887,223 bp (GRCm38)
  • T to A, chromosome 14 at 121,583,369 bp (GRCm38)
  • C to T, chromosome 15 at 82,089,551 bp (GRCm38)
  • T to C, chromosome 15 at 89,099,841 bp (GRCm38)
  • A to T, chromosome 16 at 36,033,423 bp (GRCm38)
  • A to G, chromosome 16 at 94,666,054 bp (GRCm38)
  • A to T, chromosome 17 at 34,603,352 bp (GRCm38)
  • A to C, chromosome 17 at 52,978,140 bp (GRCm38)
  • T to A, chromosome 17 at 87,746,110 bp (GRCm38)
  • G to T, chromosome 19 at 3,902,543 bp (GRCm38)
  • T to A, chromosome 19 at 57,380,666 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9233 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069063-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.