Loading Mouse GIF
Loading...

Strain Name:
C57BL/6J-MtgxR9263Btlr/Mmmh
Stock Number:
069083-MU
Citation ID:
RRID:MMRRC_069083-MU
Other Names:
R9263 (G1)
Major Collection:

Strain Information

Suz12
Name: SUZ12 polycomb repressive complex 2 subunit
Synonyms: 2610028O16Rik, D11Ertd530e
Type: Gene
Species: Mouse
Chromosome: 11
NCBI: 52615
Homologene: 32256
Smc2
Name: structural maintenance of chromosomes 2
Synonyms: 5730502P04Rik, CAP-E, Fin16, Smc2l1
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 14211
Homologene: 4705
Pcm1
Name: pericentriolar material 1
Synonyms: 9430077F19Rik, 2600002H09Rik, C030044G17Rik
Type: Gene
Species: Mouse
Chromosome: 8
NCBI: 18536
HGNC: HGNC:8727
Homologene: 4518
Lrp5
Name: low density lipoprotein receptor-related protein 5
Synonyms: LRP7, LR3
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 16973
HGNC: HGNC:6697
Homologene: 1746
Dab2ip
Name: disabled 2 interacting protein
Synonyms: 2310011D08Rik, AIP1
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 69601
Homologene: 13058
Fry
Name: FRY microtubule binding protein
Synonyms: cg003, 9330186A19Rik
Type: Gene
Species: Mouse
Chromosome: 5
NCBI: 320365
Homologene: 113770
Epcam
Name: epithelial cell adhesion molecule
Synonyms: Ep-CAM, panepithelial glycoprotein 314, GA733-2, TROP1, Ly74, Egp314, EpCAM, gp40, CD326, EGP-2, Tacstd1, EpCAM1
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 17075
VEGA: 17
Homologene: 1764
Lrp6
Name: low density lipoprotein receptor-related protein 6
Synonyms: skam26Jus, Cd, ska26, skax26
Type: Gene
Species: Mouse
Chromosome: 6
NCBI: 16974
HGNC: HGNC:6698
Homologene: 1747
Cdc42bpg
Name: CDC42 binding protein kinase gamma
Synonyms: MRCKgamma
Type: Gene
Species: Mouse
Chromosome: 19
NCBI: 240505
Homologene: 28384
Ccdc80
Name: coiled-coil domain containing 80
Synonyms: Urb, Ssg1, 2610001E17Rik, DRO1
Type: Gene
Species: Mouse
Chromosome: 16
NCBI: 67896
Homologene: 12206
Dmxl2
Name: Dmx-like 2
Synonyms: E130119P06Rik, 6430411K14Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 235380
HGNC: HGNC:2938
Homologene: 41022
Rcor1
Name: REST corepressor 1
Synonyms: 6720480E22Rik, D12Wsu95e, Rocr1
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 217864
Homologene: 32246
Dsg2
Name: desmoglein 2
Synonyms: D18Ertd293e
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 13511
HGNC: HGNC:3049
Homologene: 1464
Dnaja1
Name: DnaJ heat shock protein family (Hsp40) member A1
Synonyms: Hsj2, Nedd7
Type: Gene
Species: Mouse
Chromosome: 4
NCBI: 15502
HGNC: HGNC:5229
Homologene: 55588
Katnip
Name: katanin interacting protein
Synonyms: D430042O09Rik
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233865
Homologene: 45841
Slc25a47
Name: solute carrier family 25, member 47
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 104910
VEGA: 12
Homologene: 64441
Vwa3b
Name: von Willebrand factor A domain containing 3B
Synonyms: A230074B11Rik, 4921511C04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70853
Homologene: 27053
Ttn
Name: titin
Synonyms: connectin, L56, mdm, 1100001C23Rik, D830007G01Rik, 2310036G12Rik, 2310074I15Rik, 2310057K23Rik, D330041I19Rik, shru
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 22138
Homologene: 130650
Trak2
Name: trafficking protein, kinesin binding 2
Synonyms: GRIF-1, CALS-C, OIP98, GRIF1, 4733401O11Rik, Als2cr3, 2900022D04Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 70827
Homologene: 22861
Xirp2
Name: xin actin-binding repeat containing 2
Synonyms: A530024P18Rik, 2310008C07Rik, 2310003D02Rik, mXin beta, myomaxin, Cmya3
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 241431
Homologene: 19388
Cacna1d
Name: calcium channel, voltage-dependent, L type, alpha 1D subunit
Synonyms: D-LTCC, Cchl1a, Cchl1a2, Cacnl1a2, 8430418G19Rik, Cav1.3alpha1, C79217
Type: Gene
Species: Mouse
Chromosome: 14
NCBI: 12289
VEGA: 14
HGNC: HGNC:1391
Homologene: 578
Fbn2
Name: fibrillin 2
Synonyms: sy, Sne, Fib-2
Type: Gene
Species: Mouse
Chromosome: 18
NCBI: 14119
VEGA: 18
HGNC: HGNC:3604
Homologene: 1515
Rp1
Name: retinitis pigmentosa 1 (human)
Synonyms: oxygen-regulated protein 1, Orp1, mG145, Dcdc3, Rp1h
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 19888
Homologene: 4564
Sycp2
Name: synaptonemal complex protein 2
Synonyms: 3830402K23Rik, 4930518F03Rik
Type: Gene
Species: Mouse
Chromosome: 2
NCBI: 320558
Homologene: 8604
Arhgef38
Name: Rho guanine nucleotide exchange factor 38
Synonyms: 9130221D24Rik, D630013G24Rik
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 77669
Homologene: 137396
Kmt2d
Name: lysine (K)-specific methyltransferase 2D
Synonyms: C430014K11Rik, Mll4, Mll2, bapa
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 381022
HGNC: HGNC:7133
Homologene: 86893
Pex6
Name: peroxisomal biogenesis factor 6
Synonyms: D130055I09Rik
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 224824
HGNC: HGNC:8859
Homologene: 47914
Dscc1
Name: DNA replication and sister chromatid cohesion 1
Synonyms: 2010006I05Rik, 2600005O03Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 72107
Homologene: 5464
Dnajb7
Name: DnaJ heat shock protein family (Hsp40) member B7
Synonyms: mDj5, 4933424H20Rik
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 57755
Homologene: 77343
Tbx18
Name: T-box18
Synonyms: 2810012F10Rik, 2810404D13Rik
Type: Gene
Species: Mouse
Chromosome: 9
NCBI: 76365
Homologene: 11384
Tufm
Name: Tu translation elongation factor, mitochondrial
Synonyms: EF-TuMT, 2300002G02Rik, C76308
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 233870
Homologene: 2490
Sec16b
Name: SEC16 homolog B, endoplasmic reticulum export factor
Synonyms: Rgpr-p117, Rgpr, Lztr2
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 89867
Homologene: 13227
Sirpb1a
Name: signal-regulatory protein beta 1A
Synonyms: 9930027N05Rik, Sirpb1
Type: Gene
Species: Mouse
Chromosome: 3
NCBI: 320832
Homologene: 82993
Hsd17b7
Name: hydroxysteroid (17-beta) dehydrogenase 7
Synonyms: ERG27
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 15490
HGNC: HGNC:5215
Homologene: 40728
Slco4c1
Name: solute carrier organic anion transporter family, member 4C1
Synonyms: SLC21A20, PRO2176, OATP4C1, OATP-M1, OATP-H, C330017E21Rik
Type: Gene
Species: Mouse
Chromosome: 1
NCBI: 227394
Homologene: 62654
Pacsin1
Name: protein kinase C and casein kinase substrate in neurons 1
Synonyms: A830061D09Rik, Syndapin I
Type: Gene
Species: Mouse
Chromosome: 17
NCBI: 23969
HGNC: HGNC:8570
Homologene: 22674
Syne3
Name: spectrin repeat containing, nuclear envelope family member 3
Synonyms: nesprin-3beta, nesprin-3alpha, nesprin-3, 4831426I19Rik
Type: Gene
Species: Mouse
Chromosome: 12
NCBI: 212073
VEGA: 12
Homologene: 17625
Sstr3
Name: somatostatin receptor 3
Synonyms: sst3, Smstr-3, Smstr3
Type: Gene
Species: Mouse
Chromosome: 15
NCBI: 20607
VEGA: 15
Homologene: 20285
Akr1c14
Name: aldo-keto reductase family 1, member C14
Synonyms: 9030611N15Rik
Type: Gene
Species: Mouse
Chromosome: 13
NCBI: 105387
Homologene: 138093
Sephs2
Name: selenophosphate synthetase 2
Synonyms: Ysg3, Sps2
Type: Gene
Species: Mouse
Chromosome: 7
NCBI: 20768
Homologene: 7550
Rdh16
Name: retinol dehydrogenase 16
Synonyms: CRAD1, cis-retinol/androgen dehydrogenase 1, Rdh6
Type: Gene
Species: Mouse
Chromosome: 10
NCBI: 19683
Homologene: 129514
Genetic Alterations
ENU-induced transitions at the following base pair locations:
  • A to T, chromosome 1 at 4,348,452 bp (GRCm38)
  • A to G, chromosome 1 at 4,348,937 bp (GRCm38)
  • C to A, chromosome 1 at 37,060,412 bp (GRCm38)
  • T to C, chromosome 1 at 58,946,322 bp (GRCm38)
  • A to T, chromosome 1 at 96,871,784 bp (GRCm38)
  • G to A, chromosome 1 at 157,532,178 bp (GRCm38)
  • A to G, chromosome 1 at 169,967,264 bp (GRCm38)
  • A to G, chromosome 2 at 35,712,879 bp (GRCm38)
  • A to G, chromosome 2 at 67,514,945 bp (GRCm38)
  • G to A, chromosome 2 at 76,890,524 bp (GRCm38)
  • A to G, chromosome 2 at 178,394,138 bp (GRCm38)
  • T to C, chromosome 3 at 15,416,932 bp (GRCm38)
  • AC to A, chromosome 3 at 56,090,972 bp (GRCm38)
  • T to G, chromosome 3 at 133,160,768 bp (GRCm38)
  • T to A, chromosome 4 at 40,724,133 bp (GRCm38)
  • A to G, chromosome 4 at 52,470,848 bp (GRCm38)
  • T to G, chromosome 5 at 150,399,263 bp (GRCm38)
  • T to C, chromosome 6 at 134,480,504 bp (GRCm38)
  • T to A, chromosome 7 at 125,870,695 bp (GRCm38)
  • A to G, chromosome 7 at 126,488,928 bp (GRCm38)
  • C to T, chromosome 7 at 127,272,950 bp (GRCm38)
  • T to A, chromosome 8 at 41,279,753 bp (GRCm38)
  • T to C, chromosome 9 at 54,451,661 bp (GRCm38)
  • C to A, chromosome 9 at 87,729,468 bp (GRCm38)
  • C to T, chromosome 10 at 77,794,994 bp (GRCm38)
  • A to G, chromosome 10 at 127,813,437 bp (GRCm38)
  • A to G, chromosome 11 at 80,013,261 bp (GRCm38)
  • T to C, chromosome 12 at 104,968,156 bp (GRCm38)
  • C to G, chromosome 12 at 108,854,289 bp (GRCm38)
  • T to A, chromosome 12 at 111,111,893 bp (GRCm38)
  • T to C, chromosome 13 at 4,063,620 bp (GRCm38)
  • G to A, chromosome 14 at 30,074,968 bp (GRCm38)
  • C to A, chromosome 15 at 55,084,109 bp (GRCm38)
  • G to T, chromosome 15 at 78,539,592 bp (GRCm38)
  • G to A, chromosome 15 at 81,408,065 bp (GRCm38)
  • TGCTGCTGCTGCTGCTGCTGG to TG, chromosome 15 at 98,849,618 bp (GRCm38)
  • T to A, chromosome 16 at 45,095,586 bp (GRCm38)
  • A to G, chromosome 17 at 27,704,950 bp (GRCm38)
  • A to G, chromosome 17 at 46,712,305 bp (GRCm38)
  • A to G, chromosome 17 at 87,640,532 bp (GRCm38)
  • T to A, chromosome 18 at 20,594,166 bp (GRCm38)
  • T to C, chromosome 18 at 58,124,272 bp (GRCm38)
  • T to C, chromosome 19 at 3,604,190 bp (GRCm38)
  • T to C, chromosome 19 at 6,322,119 bp (GRCm38)
  • A to G, chromosome X at 49,795,314 bp (GRCm38)
Phenotype
G1 male heterozygous mice are viable and fertile. The G1 mice were not characterized prior to archiving.
Strain Development
C57BL/6J mice were injected with ENU, resulting in G0 mice that were bred back to C57BL/6J. Sperm was archived from G1 male mice that produced viable G2 mice.
Suggested Control Mice
Wild-type littermates or C57BL/6J mice
MMRRC Genetic QC Summary
The MMRRC Centers have developed a genetic QC pipeline using MiniMUGA array genotyping to provide additional information on strain backgrounds for MMRRC congenic and inbred strains. For more information on when data may be available, or to request genotyping for a strain of interest, please contact mmrrc@missouri.edu. Older strains may not have this information.
Donor
Bruce Beutler, M.D., University of Texas Southwestern Medical Center.
Primary Reference
MUTAGENETIX record for R9263 (G1). B. Beutler and colleagues, Center for the Genetics of Host Defense, UT Southwestern, Dallas, TX.

Colony and Husbandry Information

Colony Surveillance Program and Current Health Reports

Mice recovered from a cryo-archive will have health surveillance performed on recipient females. Health reports will be provided prior to shipment. If you require additional health status information, please email mmrrc@missouri.edu.
Coat Color
Black
MMRRC Breeding System
Random intra-strain mating
Breeding Scheme(s)
When maintaining a live colony, heterozygous mice may be bred together, bred with wild-type siblings, or bred with C57BL/6J inbred mice.
Overall Breeding Performance
Undetermined; during development, mating was done with heterozygous males; viability, fertility and other breeding statistics for heterozygous females and homozygotes are unverified, but presumably would be similar to the C57BL/6J background strain
Average litter size
Undetermined
Recommended wean age
3 weeks

Order Request Information

Limited quantities of breeder mice (recovered litter) are available from a cryoarchive; recovered litter usually available to ship in 3 to 4 months.

Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

Distribution of this strain requires submission of the MMRRC Conditions of Use (COU). A link to the COU web form will be provided via email after an order has been placed; the form should be completed then or the email forwarded to your institutional official for completion.

The donor or their institution limits the distribution to non-profit institutions only.

Additional charges may apply for any special requests. Shipping costs are in addition to the basic distribution/resuscitation fees. Information on shipping costs and any additional charges will be provided by the supplying MMRRC facility.

Click button to Request this one strain. (Use the MMRRC Catalog Search to request more than one strain.)
MMRRC Item # Description Distribution Fee / Unit (US $)
*Shipping & Handling not included*
Units Notes
069083-MU-RESUS Litter recovered from cryo-archive $5,475.00 / Non-Profit Litter Recovered litter4; additional fees for any special requests.
Cryopreserved material may be available upon request, please inquire to mmrrc@missouri.edu for more information.

1 The distribution fee covers the expense of rederiving mice from a live mouse; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

2 An aliquot contains a sufficient number of embryos (in one or more vials or straws and based on the transfer success rate of the MMRRC facility) to transfer into one to three recipients. The MMRRC makes no guarantee concerning embryo transfer success experienced in the recipient investigator's laboratory. Neither gender nor genotype ratios are guaranteed.

3 An aliquot is one straw or vial with sufficient sperm to recover at least one litter of mice, as per provided protocols, when performed at the MMRRC facility. The MMRRC makes no guarantee concerning the success of these procedures when performed outside the MMRRC facilities.

4 The distribution fee covers the expense of resuscitating mice from the cryo-archive; you will receive the resulting litter. The litter will contain at minimum one mutant carrier; the actual number of animals and the gender and genotype ratios will vary. (Typically, multiple breeder pairs can be established from the recovered litter.) Prior to shipment, the MMRRC will provide information about the animals recovered. If you anticipate or find that you need to request specific genotypes, genders or quantities of mice in excess of what is likely from a resuscitated litter, you may discuss available options and pricing with the supplying MMRRC facility.

To request material from the MMRRC: Please fill out our on-line request form (accessible from the catalog search results page, or click the Request this Strain button in the fees section). If you have questions or need assistance completing this form, you may call Customer Service at (800) 910-2291 (in USA or Canada) or (530) 757-5710 (international calls). Before you call, please have with you: the MMRRC item number, quantity needed, Bill-to and Ship-to contact information.